Microarray Probes on PGSC0003DMT400083203

Probe IDChipProbe Sequence
CUST_3006_PI426222305 JHI_St_60k_v1 CTATGTACATAAAATAAACTTTGTAGAACATTTGCCACCACCCCCTTCACACTGAAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400083203

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400083203 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G19040.1 +1 1e-96 301 157/286 (55%) isopentenyltransferase 5 | chr5:6362389-6363381 REVERSE LENGTH=330

Transcript Sequence (1670 bp)

>PGSC0003DMT400083203 1670 pgsc_dm_v3.4
AAACAAGAGATATATCCTTTTTTCTATCTTCTAACAACCTTAGTTACATACATATTGATG
AAAAATACATAAAATTAGTTCCAAGCTCTCTGCACACTATTTTTTTTCCTATTTTCTTCT
CAACGTTCGCCGCATAAATAAAGGTTTGTAATTAACTTAACTAACACGACGATGAATATT
GTGTTACAACATATTGCACCAACATTTGTTTCTTGCAAACATCAACCACTTAATAATTTC
CGGGATGGTCTAACGATTGATCCATTTATTCCCCCTCGACGAAAGGACAAGGTGGTGATA
GTTATGGGTGCAACAGGAACGGGAAAATCTAGACTTTCCATTGATCTAGCCAAACATTTT
TCAGCAGAGGTTGTGAATAGTGATAAAATGCAAATTTATGAAGGTCTTGATATTATAACA
AATAAGGTTACCGATAAGGAGACTTGTGGAATTCAACATCATTTGTTATCAATTATTGAT
CCTAACGAAGTTTTCACTGCGACGGACTTTTGTCAACGTGCTACAAAAGCTGTGGATTCT
ATCATAAGTAAGGGTCAACTACCGATCATTGCCGGAGGGTCAAATTCGTACATTAAGGCA
CTAGTGAATGATGACATTGAATTTAAGTCCAGGTATGAATGTTGTTTTCTTTGGATCGAT
GTAAATTTGAAAATACTACAAAGGTTTGTGTCAAAAAGAGTCGATAAGATGGTGAAAGAA
GGGCTTGTAGAGGAAGCAAGGGAATTTTTCAACCCTGATGGCGATTACACAAGTGGAATT
AGACGTGCAATTGGAGTACCAGAAATGCACCAATATTTCATTAATGAGAATAATAAGAAT
ACCCGGGACAAGATGCTTCAAATTGCTATTGAAAATATTAAAGTCAATACATACAAATTG
GCTTGTTGCCAACGTCAAAATATTCGTAGACTTGAAAGCCAATTTGAATGGAAAATAAAT
CGACTTGATGCCACTGAAGCATTTGAAAAAAAAGGTATTGAATCAAATCAAGCATGGCAT
AATATTGTTTATGAACAAAGTACTCAAATTGTTCGTCATTTTCGCGGTGAAGAACTTCTC
AATATCCCCTCTCCTCCTCCTCCTTCTTCTTCTTCTTCTTCGTCAACTTCCTTCTTGCCC
AAAGTTGCTACTATGACGCACTAGAAGAATATTGCCCACATATTGATATATGTTTACTAT
ATATATCTTCATAGTGTGACAATATTTGCTAAAATCAATAACATCATCACTACATACGTT
TGAATCTTTGTTTGTACACCCAACAATAGATCTTTCATGATCAGACATCTCGTCTGTATG
GAAGAATGGAACTACTACTCTCTTGGTGGGAAGTGCCTTATTCCCCTAGCTACATAAAGT
TGAGTGGTGGCAGCTATATGCGCGCACAAGCCAATTTTTGATACCCTATGTCATTGGGTA
TTTTTCTTTATATGGGGTTTTGTTTAAACTTTTTGAATGTCTATGTTGTATTCTATGTAC
ATAAAATAAACTTTGTAGAACATTTGCCACCACCCCCTTCACACTGAAAAAAAAAAAGGG
AGACTTAGTGGCATTTTGGATTTTATATATATTCTGTACTTTGACATGAGCTGTATTATT
CTATATATCACTTTAATGTAAAATTAAAGTATTTTGCATGTATGTACTAT