Microarray Probes on PGSC0003DMT400083090

Probe IDChipProbe Sequence
CUST_28816_PI426222305 JHI_St_60k_v1 GAATTTTCTAGAGTTAGAGGTTGGGATCAGTATCACAGTCCTAGAAACCTTCTCCTAGCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400083090

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400083090 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G25400.1 +2 5e-38 131 74/107 (69%) CONTAINS InterPro DOMAIN/s: NTP Pyrophosphohydrolase MazG-related, RS21-C6 (InterPro:IPR011394), EAR (InterPro:IPR009039), NTP pyrophosphohydrolase MazG, putative catalytic core (InterPro:IPR004518); Has 1123 Blast hits to 1121 proteins in 452 species: Archae - 22; Bacteria - 753; Metazoa - 81; Fungi - 3; Plants - 83; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink). | chr3:9213236-9214144 FORWARD LENGTH=141

Transcript Sequence (608 bp)

>PGSC0003DMT400083090 608 pgsc_dm_v3.4
AAGAAATATAATGGAGAATAATAATAATAATAATTCTCATGATCAATATGGTAGAAAAGT
GATGAAGGATGTCTCTCTTCAGGAGCTTAGAGAGAGGCTTGTTGAATTTTCTAGAGTTAG
AGGTTGGGATCAGTATCACAGTCCTAGAAACCTTCTCCTAGCTTTGGTTGGAGAAGTGGG
AGAGCTATCAGAGATATTTCAGTGGAAGGGTGAAGTTGCAAGGGGTTTACCTAACTGGAC
ATCAGATGATAAGGAACATTTGGAAGAAGAACTTTCTGATGTTTTACTCTATTTGGTTCA
GCTAGCTGATGTTTGTGGACTTGATTTAGGTCAAGCAGCACTTACTAAGATTGTCAAAAA
TGCTCAAAAATACCCTGTTACTAAACCTACTTAATTATCACAAATTAAGCTAGCTAGTGC
TATCTTCTTGTCAGGGTGTGTCCTTTTTTTGAACTTTTAAGTTATATATGTTTAAGCAGT
TAATTATGTAAGAAATATTTTATACCATTAGCCATTAGGTCCCCCTAAAATATAGCTACA
TGTATGTCTGATATAGAAAGTAAGACATGTTATCTATGGTAATGTATGAGAGTTTTGTGG
TAGCCATC