Microarray Probes on PGSC0003DMT400082699

Probe IDChipProbe Sequence
CUST_52716_PI426222305 JHI_St_60k_v1 TAACAGTTGTACACGTTGATTGCAGTGGCGGAGGAAGGATTTTCATCAACGGGGTTCAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400082699

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400082699 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G23660.1 +1 2e-44 152 69/101 (68%) homolog of Medicago truncatula MTN3 | chr5:7971936-7973796 REVERSE LENGTH=285

Transcript Sequence (588 bp)

>PGSC0003DMT400082699 588 pgsc_dm_v3.4
TTGTGGGATTTTCTATCTTTTATACAAGCTAAGTGAGAAAGAAAAAGAGCAAGGTTTCTC
GAGAGACCCTAAATAAATCCTTTCTTCCCAAATTTGAATACATTTGTATCATTCAATAAC
TTAATCACAATCAACATGGCCTTATTTGACCTCCACCATCCATGGCTCTTCGTGTTTGGA
GTCTTAGGAAACGTTATCTCCATATTGGTCTTCTTAGCTCCAGTGCCAGCATTCCGACGA
ATCTGCAAAGAAAAATCAACGATGGGTTATCAATCAGTACCTTACGTGGTAGCACTATTT
TCATCGATGTTATGGATGTATTATGCATTTATCAAGAAAAACGCCATTCTTCTTGTCTCC
ATCAACTCCTTTGGTTGCATTGTTGAGACCATTTACATCACCATTTTCATTCTCTACGCA
TCCAAGGAGGCTAGGGTAAGTTTTCATTATGATGTACCTACTATAGTTGAACAGGTTGAA
CAACGTGGTACAATCAACTCTATAACAGTTAACAGTTGTACACGTTGATTGCAGTGGCGG
AGGAAGGATTTTCATCAACGGGGTTCAAAAAAAAATTAATCACATAAA