Microarray Probes on PGSC0003DMT400082143

Probe IDChipProbe Sequence
CUST_52549_PI426222305 JHI_St_60k_v1 CATCAAGCGAATTGTATTTAGGATTCTCTTTCGGCAATTTAAAGCCATACACACCTTGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400082143

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400082143 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G20340.1 +1 1e-07 49 29/61 (48%) Expression of the gene is downregulated in the presence of paraquat, an inducer of photoxidative stress. | chr3:7093075-7093422 REVERSE LENGTH=115

Transcript Sequence (666 bp)

>PGSC0003DMT400082143 666 pgsc_dm_v3.4
GAACTTGCTAATTAGCTACTAAAATTCATATCTTCTTCTATGGGAAATTGTATTAGAAAA
GAATCCTTTCCCTCTCCTTTACTAAAGGCGAAAACCGTGAATTTGGAGGATGAACTTCTT
CTCATGGAAGAAAATAAGGATTGTATTTATTCTTCTGCGAGCTTAACAAAAGAGGTAAAG
ATAAAGATCACGAAGAAACAATTGTTTGAGTTAATGGGTAAAGCAGATGTTCAAGGCCTA
TCCGTACATCAACTACTGAAGCAGTTGATGAACGTTACGGAAGGCCTTGAGTTGCGTCAG
CGCTCATGGAGGCCTGCCTTACAGAGTATACCTGAGGTCAATTAGGTGTCCTCTTATTTT
TTACGAGGGTTTATTAGTATGTTTATATGTTATTCAGACTTTTATTGGGTGTGTCAGATC
CTCCAAAAGTAGGAGTGGGTGTGTCTCTAATCCTCCAAAAGTAGGAGTGGGTGTCTTTGA
TCCTCCAAAAATAGGAGGATCCGATCGATAAGACTAACAACATTTTTGAAAAGGTCTAGC
AAGCAACAACATATAGATATTGTGTATATAAGAGTTTAATATACATCCATCAAGCGAATT
GTATTTAGGATTCTCTTTCGGCAATTTAAAGCCATACACACCTTGTATATAAAGTTTAAT
TTTGAA