Microarray Probes on PGSC0003DMT400081825

Probe IDChipProbe Sequence
CUST_28020_PI426222305 JHI_St_60k_v1 ATGAGCTGGTATTGATGCTAATCAGGCATACTTTATATTCGTTTTGACCATGTTCAGATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400081825

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400081825 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G10250.1 +1 7e-28 115 68/175 (39%) Plant protein 1589 of unknown function | chr3:3168371-3170418 REVERSE LENGTH=324

Transcript Sequence (1862 bp)

>PGSC0003DMT400081825 1862 pgsc_dm_v3.4
CTTGAAAAAGCTATGTATATAGTTATTTCGTCTCTAATGTGTTCCACACGTGCAAGTGTT
AATTCTCCTACAACTCCCCTTACAATGTTGTATTCCGTTCTTAAGAAAAGAGATTTTCAC
ATACTGCCAGTATGATACTGGGGCCAGTGTTAGTTGGGCGCTAATGTAGGAGGAATGCCA
GATGTAGTGTTCATGGGTATGGAACTATGTATTGTTAGAATGTCAAGTGTTAGCTTTAGA
ATAGTGTTAAAGAATGAGATGATAATTTTGTTGTCCAACGTCAAACAAGTACTATGTAAG
TCTTGGGTTTGACACCAATAAGTTGGTGTCTTGTATTCCATTATCGTTAAGTCTTCAATG
TCTTATCTTCTATTTTTATTTTTCCACTTGGTACCAAGGCAGCACTATGTTCCTATGTTC
CTTTCTGGCAACCATTCTGGCATCAGCTCACCTTTTTCTGATGAATGTTCTGGTGATACC
ACACCTCTTTATGGTGACTGTTCTAGTAGTGCCATGCCTTTCTGGGTGACCGTTTCAAGG
ACGCTGCGTCTCTTGTGCTGACGATTTCTAGTATTTGCATCTTTCTGGCCATTGTTTTGA
GCAACATCTTTTCTGCTGAGTTAACGGAGACCAGAGCTGTTCAGCCAGATTTTCTGGTCA
AAAGATTTAGCTGTACCTGTATAAGACGGAAGAGAAGACGTAGCACATGAGATGTTGCTC
CTCTTATGTCGAGAGAAGAATACTGAATTTTTGATTGAGTAGAGAAGGATTTTGCATTTA
AGGAATAACCTCTTACCCCTTACTTCTTTGGTGCATCCATGAGGTTCCCCACTTGTATAG
AAGTTTGGGTGCCTTTCGGAGAAAGCCATATCATCACTGTTTAGTTTACCTCTTGTATAA
GGGCAATTGTTGTTCTTGTTCTTTTGAATGAGATTTATTACATTATCAAAAAGATTTAGC
TTAGTTTGTCTGATCTTTTCTGCAACAAGCATGACGAGCATCGTTTTCAGTATGGAGCCT
GCCACTAAGCTTTTGTCTAGACTTATCCTTATCTTCATTGCCTTCTATTTGCTTGTTACC
TGTGTTCTTGCTAGAACCTGCATTTGAGAAGCTGTGTTGTTGTCTCTAGTTAATGTTAAG
TTTTCTTGCCTTACTGCAGTGCATCAAAGTTCAACTTGTGGTGCTGCGGAAAATGTTGGA
ACTGCTGCAAAGCCTAATGGCATGCACGAACCTGTACATGCTGATAGACCCAATGCATTC
AGTAACAGCAGCTCATCTGTTCTCTCTTGCATGCAAACAACAATTGATATTCCTTCTCAA
AGCAGGAAAATTGATGGTCCTCCTAGTATGTTTTTGGGCCAGCCCTCTAACATGGGGATG
AGACAAACAATGGATGGGAGGATTATTAAGACAGAACCTATCTATGGTGGCAATTCTCCG
TTTGCCTTTGGTCCTCATGGCACTTACTTGGAGTCACGTTCTGCAATGGGCGATGCATCT
GTTTCATCGTTTAGTAGTGTGGAGTCGAACACACAACCTCTTAATGAACCTCTTCTGGAT
GCTGACACTTCTTCGTTTGGATATCTAGGGGATATACCTCAAAATTTTGGTTTCTCAGAC
TTGACTGTTGATTTCACTAATAGTTCTGGTATGTGTCTTCCTCTCCCTATTTTCTCCGTA
ATTTCACCAAGCATCTCTGGATTCGTCTTTTTCACTTTCAACGTTTCAGGTATTAAAATG
AGCTGGTATTGATGCTAATCAGGCATACTTTATATTCGTTTTGACCATGTTCAGATATAT
TAGGGAGCTACTCTAGGACTCCCTTTCTAGCAACAGATACTGGCAACTTGCTCGATTCAA
AT