Microarray Probes on PGSC0003DMT400081778

Probe IDChipProbe Sequence
CUST_27907_PI426222305 JHI_St_60k_v1 TGTCAACTTTGGTTTAGCTCTAGCTAGACATCCTAGTATCCAATTGGTTTGGTCTTTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400081778

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400081778 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G17860.1 +2 1e-44 162 122/343 (36%) jasmonate-zim-domain protein 3 | chr3:6119968-6122691 FORWARD LENGTH=352

Transcript Sequence (1457 bp)

>PGSC0003DMT400081778 1457 pgsc_dm_v3.4
CTATAAACTATTTCTCTTTCATTCCTTTCTCACTTTTCTTTGCTTTTGGGTTTCTGGGGT
TTCTTGTTTTTTTTTTCTAGTTTTGTTTGAGTTTGATCTGCTTCTTGGGGTTCTTTAAAT
TTTCTTGAAATCTTGAATTTTGGGTGTTTCTTGAAAATTCAAAGAGATGGAGAGGGACTT
TATGGGATTGAATATTAAAGATTCTTTAGCTGTAGTCAAGGAAGAACCTGTTGAAAGCTC
CAAAGACTCTGGGTTTCGCTGGCCAATGTCGAGTAAGGTTGGTGTACCTCATTTCATGTC
CTTGAACTCTGCTCACGATGAGAACACCTTCAAAGCTCTATCTGCCACAGATGGAGTCGA
TGCTGGTGTCAAACGTCAGTCTGGTGAACTCCAGAATGTGCATGCAATTCATCTTCCGTA
TGATGTTAAGATGCTTCCATTTAACATGAACAATCCCTCCTACAAGACTCATTTTGGTGG
TTCTGGCCAGATGAAGCAAGTTCTTGGTGGAATTCCTGTTACAGCTCCACATTCAATGCT
TCCATCGCGTGGCTCTGTGGCTGGGACAACCGAACCTTGGTTTAATTCCAAAAGTTGTGC
AGCACCTGCTCAACTGACCATCTTCTATGGTGGGACGGTCAATGTCTTCGAGGATATCTC
CCCTGAGAAGGCACAGGCTATTATGTTTTTGGCTGGACATGGCTGCGCTCCACCTAATGT
GGTGCAACCAAGGTTTCAACTTCAGGCATCTGCATCGAAACCTGCTGCTGCGGATGGTGT
TTGTGTGAACCAAACCCCAAACATGCTGCCTGCCTCGGGTCTTTCTAGCCCTATGTCCGT
TTCTTCCCATCCTATTGGTCAATCTGATGGCAGTTCTGGAAACAAAGATGACATGAAGAT
GTCTAAAACTGCAAACAGTTCAGTGACTCCCCTTGTCAAATTGGACACTTCAAAGATTGT
GACATCACTAGGACCTGTTGGGGCGACTACCATAATGACAGCAGCGGTTCCACAAGCTAG
GAAAGCATCTCTGGCTCGTTTTCTGGAGAAGCGTAAGGAAAGGGTGATGAACTTAGCACC
ATATTGCCTCAGCAAGAAATCGCCCGAGTACTCCACCCCCGAGTCTAATGGAGTTGGTTT
CTCTGCAACTTCCAGTCCTCTATTAGCTGGTAAGGAGACCTAGCTATGATCTCTGAAGAC
TGCTTAACGCCGTAAATCAGTGAAGCATAATCTATTTTATTCAGCAAGTTAAAATCTGTG
TAGCTATCAAGTTTTGTTTGTTGTAATTTGTAATGTCAACTTTGGTTTAGCTCTAGCTAG
ACATCCTAGTATCCAATTGGTTTGGTCTTTTTTTTTCTGAAACCTGATGGAATATTTCCC
ATCCAAATAACTTCTTCAATTTGTAACTATTTATTTTGTTACATTGTGTTTCACAAGTAT
ATATATATATATATATA