Microarray Probes on PGSC0003DMT400081777

Probe IDChipProbe Sequence
CUST_27922_PI426222305 JHI_St_60k_v1 TGTCAACTTTGGTTTAGCTCTAGCTAGACATCCTAGTATCCAATTGGTTTGGTCTTTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400081777

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400081777 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G17860.1 +2 3e-39 146 119/343 (35%) jasmonate-zim-domain protein 3 | chr3:6119968-6122691 FORWARD LENGTH=352

Transcript Sequence (1361 bp)

>PGSC0003DMT400081777 1361 pgsc_dm_v3.4
CTATAAACTATTTCTCTTTCATTCCTTTCTCACTTTTCTTTGCTTTTGGGTTTCTGGGGT
TTCTTGTTTTTTTTTTCTAGTTTTGTTTGAGTTTGATCTGCTTCTTGGGGTTCTTTAAAT
TTTCTTGAAATCTTGAATTTTGGGTGTTTCTTGAAAATTCAAAGAGATGGAGAGGGACTT
TATGGGATTGAATATTAAAGATTCTTTAGCTGTAGTCAAGGAAGAACCTGTTGAAAGCTC
CAAAGACTCTGGGTTTCGCTGGCCAATGTCGAGTAAGGTTGGTGTACCTCATTTCATGTC
CTTGAACTCTGCTCACGATGAGAACACCTTCAAAGCTCTATCTGCCACAGATGGAGTCGA
TGCTGGTGTCAAACGTCAGTCTGGTGAACTCCAGATGAAGCAAGTTCTTGGTGGAATTCC
TGTTACAGCTCCACATTCAATGCTTCCATCGCGTGGCTCTGTGGCTGGGACAACCGAACC
TTGGTTTAATTCCAAAAGTTGTGCAGCACCTGCTCAACTGACCATCTTCTATGGTGGGAC
GGTCAATGTCTTCGAGGATATCTCCCCTGAGAAGGCACAGGCTATTATGTTTTTGGCTGG
ACATGGCTGCGCTCCACCTAATGTGGTGCAACCAAGGTTTCAACTTCAGGCATCTGCATC
GAAACCTGCTGCTGCGGATGGTGTTTGTGTGAACCAAACCCCAAACATGCTGCCTGCCTC
GGGTCTTTCTAGCCCTATGTCCGTTTCTTCCCATCCTATTGGTCAATCTGATGGCAGTTC
TGGAAACAAAGATGACATGAAGATGTCTAAAACTGCAAACAGTTCAGTGACTCCCCTTGT
CAAATTGGACACTTCAAAGATTGTGACATCACTAGGACCTGTTGGGGCGACTACCATAAT
GACAGCAGCGGTTCCACAAGCTAGGAAAGCATCTCTGGCTCGTTTTCTGGAGAAGCGTAA
GGAAAGGGTGATGAACTTAGCACCATATTGCCTCAGCAAGAAATCGCCCGAGTACTCCAC
CCCCGAGTCTAATGGAGTTGGTTTCTCTGCAACTTCCAGTCCTCTATTAGCTGGTAAGGA
GACCTAGCTATGATCTCTGAAGACTGCTTAACGCCGTAAATCAGTGAAGCATAATCTATT
TTATTCAGCAAGTTAAAATCTGTGTAGCTATCAAGTTTTGTTTGTTGTAATTTGTAATGT
CAACTTTGGTTTAGCTCTAGCTAGACATCCTAGTATCCAATTGGTTTGGTCTTTTTTTTT
CTGAAACCTGATGGAATATTTCCCATCCAAATAACTTCTTCAATTTGTAACTATTTATTT
TGTTACATTGTGTTTCACAAGTATATATATATATATATATA