Microarray Probes on PGSC0003DMT400081755

Probe IDChipProbe Sequence
CUST_46850_PI426222305 JHI_St_60k_v1 CAATGGGGGGTTTGCCAAGAACTTTTGAAAAAAGACGTTGTGTTTGAGATTAATTGTATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400081755

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400081755 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G15530.5 +3 0.0 1285 639/774 (83%) pyruvate orthophosphate dikinase | chr4:8864828-8870748 REVERSE LENGTH=963

Transcript Sequence (3597 bp)

>PGSC0003DMT400081755 3597 pgsc_dm_v3.4
TTTTCTTTCACATAACTCAACAGCCAATTTCCATTTTGATGTCACAAATTCTTTGAACTT
TTTCAGTTCTTCTAAAACATAGGAGACTTAGGACTTGAAGAAGAAAGATGAGTTCAACCA
TGAAGGGGTTGTTGTTAAAGCCCAATACAAATAATATGTACATGAGAAAATTAGTAAAAC
ACAAGTATGCAGAAGAGCAATTTCTAGCAAAGTACTCTTCTGTTGGCATCCATATGAATT
GTTCAAGATGGAGTAAAGTCATTAGGTGCCATCAACAAGAACCTAATGGCTTTTCAAATT
CCCCAATAACTCCAATAAAAAAGCAAAATCTTACACCTCAGGCAATTTTGAGTCCTGTTT
CAGAACCTACATCAACTGCAAAAAAGAGAGTTTATACTTTTGGAAAAGGAAGAAGTGAAT
GAAACAAGGGCATGAAGTCCTTGTTGGGAGGTAAAGGAGCAAACCTTGCTGAAATGGCAA
GCATTGGATTGTCCGTGCCGCCGGGGCTTACTATATCAACAGAAGCATGCCAGGAGTATC
AGATTGCTAAAAAGCTTCCACAAGGACTGTGGGAGGAGATACTACAAGGATTGGAAGTTG
TGGAGAAAGATATGGGGGCTTTCCTTGGGAACCCCTCCAAGCCTCTCCTTCTTTCGGTTC
GCTCTGGTGCTGCTATTTCTATGCCTGGGATGATGGATACTGTCTTGAACCTTGGACTCA
ATGATGAAGTGGTTACTGGTTTGGCCGCCAAAAGTGGAGAGAGGTTTGCTTATGACTCGT
ACAGACGATTTCTTGACATGTTTGGAGATGTGGTAATGGGCATTTCACATTCATTATTTG
CGGAGAAGTTAGAGAAGTTGAAGGATGCCAAAGGAGTGAAGCTTGATACCGAGCTCACAG
CATCTGATCTTAAACAGCTTGTGGAGCAGTACAAAAATGTCTATGTTGAAGCTAAGGGTG
AAAAGTTTCCTTCAGATCCCAAAAGACAGTTGGAGTTGGCTATCAAAGCAGTTTTTGATT
CTTGGGACAGTCCAAGAGCCATCAAATATCGGAGCATTAATCAGATAACAGGACTTAAAG
GAACTGCAGTAAACATTCAATGCATGGTGTTTGGGAACATGGGTAACACTTCAGGAACAG
GTGTTCTCTTCACTAGGAATCCGAGCACCGGCGAGAAGAAGCTCTATGGAGAGTTTCTAA
TTAATGCTCAGGGAGAGGATGTTGTCGCTGGAATTAGAACACCTCAGGACTTGGATGCAA
TGAAGGAGTGTATGCCTGAAGCATACAGGGAGCTTGTTGAGAATTGTGAGATTTTAGAGC
GACATTATAAAGATATGATGGATATCGAATTCACTGTTCAAGAAAATAGACTGTGGATGT
TACAATGCCGAACAGGGAAGCGTACGGGTAAAGGAGCTGTAAAGATAGCAGTTGACATGG
TGAATGAGGGACTTGTTGACAAGCGCGCAGCTGTAAAGATGGTGGAGCCACAGCATCTAG
ACCAACTTCTTCACCCCCAGTTTGAAAATCCATCGGCTTATAAAGACAACGTGATTGCTA
AGGGCCTTCCTGCTTCTCCTGGGGCAGCAGTGGGACAGGTCGTGTTCAGCGCTGAAGATG
CTGAAGAATGGCATGCACAAGGGAAGAGTGCTATTTTGGTTAGAACTGAAACAAGTCCAG
AGGATGTTGGAGGCATGCATGCTGCTGCGGGGATCTTAACCGCAAGAGGTGGCATGACAT
CTCATGCGGCTGTTGTAGCCCGTGGCTGGGGTAAATGTTGTGTGTCTGGATGTGCTGATA
TTCGTGTTAATGAGTCGGAAAAGGTTCTCATCATTGAAGACAAAGTGATTCATGAAGGAG
AGTGGCTTTCGTTGAACGGATCAACAGGTGAAGTAATCTTGGGCAAGCAACCACTATCGC
CTCCAGCTATGACTGGTGATTTGGAGATCTTCATGGCTTTGGCTGATAAGATCAGGCGCA
TCAAGGTTATGGCAAATGCTGACACACCAGAAGATGCACTAGCAGCAAGGAATAATGGTG
CTGAAGGGATTGGTCTATGCAGGACAGAACACATGTTCTTTGCATCAGACGAAAGGATAA
AAGCTGTGAGAAGGATGATAATGGCAGTTACTCTTGAGCAGAGGAAGGAAGCGCTCGACT
CATTGTTGCCTTACCAGAGATCTGACTTTGAAGGCATTTTCCGTGCTATGGATGGTCTTC
CGGTGACAATTCGACTGTTAGACCCACCACTTCATGAATTTTTGCCAGAAGGGAACCTGG
AAGAGATTGTGAGTGAACTAACAACACATACAGGCATGTGCGAGGAAGATGTCTATTCCA
GGATTGAGAAATTGTCAGAAGTCAATCCCATGCTCGGATTTCGAGGCTGCAGGCTAGGTA
TATCCTACCCGGAACTAACAGAAATGCAGGCTCGTGCGATCTTTCAAGCTGCTATAACTA
TGAACAACCAGGGTATTTCAGTAATTCCAGAGATAATGGTTCCCCTTGTTGGAACACCTC
AGGAATTAGGTCATCAAGTTGATTTAATCCGTGACGTTGCCAAAAAGGTTTTCGCAGAGA
TGGGTACCTCGTTGAATTATAAGGTGGGAACCATGATAGAGATTCCTAGAGCTGCTTTGA
TTGCAGATGAGGTATGTCTTTTGAAGCAACTTATTAACGATAGTCGCAAAGAGTTAAGAC
TATGCATGATCTTACTTAACTAGCGAAAGATTTTCGTTTACTTAACTCTTCAATGATATA
TTTCAATCATGAAAGGCATACATGTTGCTATATTGATTTGCTTATGCTCCATATTTTACT
GGAACTTGATGATAGATTGCTAAAGAAGCAGAGTTCTTTTCCTTCGGAACCAATGACCTC
ACACAAATGACATTTGGATATAGTAGAGACGATGTAGGTAAGTTTCTTCCTATATACCTA
GCGAAAGGCATCCTCCAACACGATCCATTCGAGGTTAGCTTGCCATATCTCAAACTACTA
TATATCCATGTGAAATGCAAAAGTTTGGAAACTAGCATGTTGACGCTTGAAGATTTAATA
TCTATCAGGTTCTTGATCAAAAGGGTGTTGGTCAGCTCATCAAGATGGCTACAGAAAAAG
GTCGGGCTGCAAGGCCAAACTTGAAGGTTGGAATTTGTGGAGAACATGGTGGGGAGCCTT
CTTCAGTTGCATTTTTTGCTGAGGCTGGATTGGACTATGTTTCTTGCTCTCCATTCAGGT
ATTTATCGACTAAAACAATGGGGGGTTTGCCAAGAACTTTTGAAAAAAGACGTTGTGTTT
GAGATTAATTGTATTAATTGACGATTGACTAATGGCTTTTTTGTATAATTCATGTGCTTA
ATCAGGGTGCCCATTGCGAGGCTAGCTGCAGCACAAGTTGTAGTAGTTTAAGAGGCAAAG
GTTTAAGGAAGAAGCAAAGATCAAGTTGATTTTTAGCAGATGTAAATAAATAAATACAAT
TAATACCATAAAAAAGAAGAAGAAAAGTTGTTTAGGAAAAGGGAACAAGATCTATTACTT
TCTTTTTTCATAAACATGAAACAAGTGTTTATATGTTAATAACAAAAAATGAAAAAG