Microarray Probes on PGSC0003DMT400081473

Probe IDChipProbe Sequence
CUST_39961_PI426222305 JHI_St_60k_v1 GCTTATGCTAATCATTTTCTTGAAGGATCGTTTGGTAGAGTGCATTAGAAAAGATAATGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400081473

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400081473 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G12900.1 +3 2e-149 449 240/396 (61%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G12330.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | chr5:4072151-4074445 REVERSE LENGTH=562

Transcript Sequence (2015 bp)

>PGSC0003DMT400081473 2015 pgsc_dm_v3.4
CTACCATATTTCAGTCCAGTCATTTCTTTGGTCCAAATGGAGTATCGCCTCATATTTTCT
GATACTCATTCCTGTGTTATCTGTTTATATTTATGAAAGTAACCAACACGGATTGTCGTG
GGATGGATCGGATCGGATCCCACCATGCTATTTGAGGTTGAGCTTTGGGTGTGAAAATAA
TCCTGTTAGGGAGCGGTAAATAGGTCTTATTTGGCGTGAATACAAATTAATTGCTCAGAT
GGATATGCTTTTTGTTCAATTTTTAATGGGAAGCCATCCTTAATTTCTGTATTTTAGGTT
ATCCTGATTCACCAAGTTTGAAATGTATGCAGAGTTATGAAGATGCTCCATTACCTGGAT
CCAAACAACTACACCTCGACGATCGAGACTACACTGACCTTTGGGATGATTATGGCCTTG
GTGGAGTAGCAAATTGTGATGAAGTCAGTCTATCGAATTACAGAAAGGCGAATTCCTCCT
TAAGGAAAGGAGTTTCATCCAATTTGATCAATTCTGATTCTCATAACTGTCCAACTGATG
ATCAGAGATCGGTCACCGGCTCTTATACTGGTCATATCACTCTGCTTAGAAACTCTCCTG
GTGGTGATTACTCTAACTCTAGAAGAAGCTCTTTGGGTGACTTGAGATCGCTTTCGTCTT
ACAATAGATCATGTAAACCTGCTATGGTAAATACTGAGACAGATGGTGCTAGCAAAAGTG
GGAAAAGCTCTAATGTAATCGTGCCATTGACAAATTCGCACTCTTTAAATCAATTGCAGC
CAAAGAGTAAAGGAATGAACTTGTCGTGGTTGTTCCCTAAGCTAAAGAAGAAAAACAAGA
ATGAAAATTCACCATATCGGAGAGAGGCCGAGGAAGTTTCTCAGATTTGTAAGGATCACA
TCGGGGTGGTTTCTGTTGAAACGTTGAGGAAAGAACTCGTGGAAGCAAATGAGAGCAGAG
AGGCAGCCTTGATGGAAGTCGCGGAAATGAAGTCTTCTTTAGGAGGGCTAAAGCAAAAAA
TGGAGTACTTAGAAACTTATTGTGAGGAGCTCAAGAAAGCCTTGAGACAAGCAATTCAAA
CAAAAGAATCCCAACTATCCAACATGCTTATAGATCTTCCGAGAAGGGGGAAATCAACGG
ATGGGGATGGAGAAAACACGATTCCTGTTAGTGAAGAGGTAATGGTTGAAGGATTCTTGC
AGATAGTATCGGAATCAAGACTATCCGTTAAGCAATTCTGCAAGACTCTTATTGCACAAG
TTGAAGAGACAGATAATTCCTTAACCGATAGCTTAAACCTTCTACTTCAACCTTACAAGC
TTTCCCTTAACTCGAAGCACTCAAAGGCGATCCTATACCATATTGAAGCCATCATAAACC
AGTCACTCTTCCAAGATTTCGAGAATGTTGTGTTCCAAAAGAACGGTGCTCCAAAACAAT
TAGACTCTCAACAAGATTGCCATGATCAATTCTCATCGTTTGTCTCGTTGAGGAACCTAA
GCTGGAATGAAGTGTTACGAAAGGGGACTAAGTACTATAGTGAAGATTTCAGTAAATTTT
GTGATCAGAAAATGTGTTGCATCATCACATCACTTAATTGGAGAAGGCCATGGCCAGAAC
AACTCCTACAAGCATTCTTTGTGGCTTCTAAGTGCATTTGGTTGTTGCATTTACTCGCGT
TTTCGTTCGATCCTCCACTTGGGATTCTGAGAGTTGAAGAGAATACAACATTTGATAAGA
ATTACATGGAGGACATATTTGGAGATAGGCAAAAATCACAAGGTACAAGTAAGGTTAAGA
TTATGGTAGTGCCTGGTTTCTATGTACGTGATAGAGTACATAGGTGTAAGGTAATTTGCA
GGTACAAATCTGCAGCTTAATTGCTAATATAGTTAGGATATCCTTCTCAATTTTTTTTAT
CTAACATGTAATGTTGATCAGCTTATGCTAATCATTTTCTTGAAGGATCGTTTGGTAGAG
TGCATTAGAAAAGATAATGCAAGATTATCTTTGTG