Microarray Probes on PGSC0003DMT400081004

Probe IDChipProbe Sequence
CUST_52774_PI426222305 JHI_St_60k_v1 TATTCTTGAGAGCCGGAGGACTTCTATTGTAATGACCCAGAAGGTTATTTTTGAAAATTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400081004

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400081004 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G23960.1 +2 2e-11 61 34/81 (42%) terpene synthase 21 | chr5:8092969-8095128 FORWARD LENGTH=547

Transcript Sequence (315 bp)

>PGSC0003DMT400081004 315 pgsc_dm_v3.4
AGATTATGGTGTATCTACAGAAGAGGCAATGAATAAGTTTCAAGAAATGGGAGAGACAGC
ATGGAAGGATATTAATGAAGGAATGCTTTGGCCAGTTCGTCCTGTCTCTACAGAAATTTT
AACTCGTATTCTCAATCTTGTTCGTATCATTGATGTGACATACAAGCACAATCAAGATGG
ATGCACACATCCGGAGAAAGTCCTAAAACCTCACATTATTGCTCTGCTTGTGAACTCCAT
TGCAATTTAAACTATTCTTGAGAGCCGGAGGACTTCTATTGTAATGACCCAGAAGGTTAT
TTTTGAAAATTTTCA