Microarray Probes on PGSC0003DMT400080992

Probe IDChipProbe Sequence
CUST_52817_PI426222305 JHI_St_60k_v1 CACTACCTTTATGGCGCTTGGAACAACTTCTTTGATTGGTATGGAGGAATTCATGATAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400080992

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400080992 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G14520.1 +3 2e-06 36 17/54 (31%) Terpenoid cyclases/Protein prenyltransferases superfamily protein | chr3:4875868-4878243 REVERSE LENGTH=605

Transcript Sequence (546 bp)

>PGSC0003DMT400080992 546 pgsc_dm_v3.4
ATGCAACTTTTGATGAACTTGTGCTTTTCACCAATGCAATACAGAGGTAATTGATGAGTA
GGAGAAATTAAACATTTTAATGACATACAATAATAGTTGATACAAATTTTTTGATGCATA
GATGGGACATAAACGCCATGGATTCATTACCGCCATATATGAGACCTTTTTATCAAGCCA
TTCTGGATATCTTCGATGAAATGGAGGAAGAATTGACCAAAGAAGGTAAATCAGACCGCG
TTTACTATGGTAAATTTGAGGTAATCCTCGCTTTCTTTGCCTCATTAATCGATTAAACTT
GTAAATTCTAGAGAAATAACAAAAATATTGGCATGAAAAATGCATACTTATGGTATGTCG
TGCTATTTTTGTGTTTTCGTTTTAGATGAAAAAGTTGGCTAGGGCCTATTTTAAAGAAGC
GCAATGGTTAAATGCTGGCTATATTCCAAATTGTGACGAGTATATAAAAAATGCAATTGT
AAGCACTACCTTTATGGCGCTTGGAACAACTTCTTTGATTGGTATGGAGGAATTCATGAT
AACAAA