Microarray Probes on PGSC0003DMT400080864

Probe IDChipProbe Sequence
CUST_52066_PI426222305 JHI_St_60k_v1 GGATTTTTGTCCAGAAAATGTATGAGAGTCCAAACATTTGGATGGAAAGGCACATTTTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400080864

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400080864 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G51920.1 +3 9e-169 503 285/617 (46%) Pyridoxal phosphate (PLP)-dependent transferases superfamily protein | chr5:21097202-21098914 REVERSE LENGTH=570

Transcript Sequence (2331 bp)

>PGSC0003DMT400080864 2331 pgsc_dm_v3.4
GGAGAAAAGGTCAAATACAGTAGCTCAAAGAAATTTATAGGAGTAATAATCAAAGGTCCC
ACATCCAGCAACCTGGCCCAAAACGCGCTTAAGGACAATGATTATAAGTCATTTTCTTGA
AAACTAAGCATATCACTATTTAAACGTGATAGCTGACTTGATAAACAGCAACAACCAAAC
AAACACAAAGAAATAGTTGAATGAATATAATTCAACAAACTGTTTAAACAAAAAAACAGT
CCACAAAGGGCTTAATGGAGGCTGAGAAAGTAACAGGCATTCATGGTTGTTGCCCCAATC
CTCTCCTTATACTTCTTGAGCCTCAAAACCATCAGCCACTTCCTAAGCCCAAAAGCACAA
CCGCAGCTTGCCGGCACACCTTTGCAGCCACAACAACTTCCTCTTTTTTCCCAAATACTC
ATTTCACTAACCATGAATCCCTTCCTTCACATCAAGAATCATCTGCTCAGTTCCTCAAAG
CTTATCCTAAGTATTCCGAATCTTGCCAAGTCGACAAGATTCGGGATCAAGAATACTATC
ATCTGTCAGTTTCTAACCATGTGTGCCTGGATTACATTGGCATTGGTCTCTTCTCTTACT
CACAGGTTCAATCACAGGTTTCTGCGGTTGTCCCGCTGACATCCTCTTCTTCTTCTCCGT
CATCTCATGAATGTAGTGAGTATCCTTTCTTTGACATATCTTGCAAGTCTGTTGATCTCA
AATCCGAGCTATTACATGGCGGTGATGGATCACAATTGGAATCCTGTATCAAGAAAAAGA
TCATGAATTTTCTTAACATGTCTACAAATGAATATTCCATGGTTTTTACTGCTAATAGAT
CATCAGCTTTCAAGCTTATAGCCGAATCTTACCCTTTCAAAACTAGTAAAAAGCTTCTTA
CAGTTTATGATCATGAGAGTGAAGCATTGGAGACTATGGTCAATACATCAGAGAAAAGAG
GGGCTAATATAATGTCAGCAGAATTTAAATGGCCACGGCTAAGAATTAACTCCGTGAAAC
TCAGGAAACTGATTATAAGGAAGAAAAAGCAAAAGAAATCAAGGGGACTATTTGTGTTCC
CCCTTCAGTCAAGAGCGACCGGAGCGAGTTACTCTTATCAGTGGATGAGTTTGGCGCAGG
AAAATGGTTGGCATGTTTTGCTTGATGCATGTGCATTGGGACCGAAGGACATGGATAGCT
TTGGACTTTCCTTAATCCATCCTGACTTCCTTATTTGCTCTTTCTATAAGGTTTTTGGTG
AAAATCCTACAGGGTTTGGATGCCTCCTTGTCAAGAAATCAGTTGTATCGATGTTGGAAG
CTTCGGTTAGTACAGGCATTGTAAGTCTTGTTCCACCAACACAACTCTTAAATTCACTAG
ATTCATCAGGCAGTGGCACGGAGCTTGAACAAAAAACCAATTTTGTTACAAAACTGGATG
AGCTGCATATATCTGGCTCTAATTCAGCTCACAATTCTGCTAAATCCACACACAACAATG
AATCTGGAAAAGATGCTCCAAAGGATAAGAGCAAAGAGGAATTAGATCAATCCATTAGTA
CACTAGGCGACAACACTAAGCTGGAAGAAAAGGGAAGCATAGAGATTCAATGCAGATGCT
TGGATCATGTGGATTCGCTCGGACTGATGCAAATTGGAAACAGAAGAAGGTATCTAGTCA
ATTGGCTTATTAGTGCACTCCTGAAACTTAAGCATCCAAATAGATTGGACCATTTTCCTC
TGGTCAAAATCTATGGACCAAAGATAAAATTTGACAGGGGAACTGCTATGGCGTTTAATC
TGTTCGACTGGAAAGGAGAAAGGGTGGAACCAATTCTCATACAGAAGCTTGCTGATCGGA
ACAATATTTCTCTCAGCCATGGGTTTCTGTCACATTTGTGGTTTCCAGACAAGTATGAGG
AAGAGAAGCAGAGGACTATAGAAGGAAAAAAGTGTGACGAAAAAGATGCACAGAACAAAA
AATCTAAAAAAACGGACTTTGGGATATCAGTAGTTACCATTGCCCTTAGCTTTCTGGCCA
ACTTTGAAGATGTTTACCGGCTTTGGACATTCATAGCTCAGTTTCTTGACGCAGACTTTG
TGGAGAAAGAACGGTGGAGATACAGCTCTCTGTATCAGAAAACGATTGAAGTTTAGCATA
GCAGTTTTTTGTCAGCAATTATGTTGCTGCAAAAGACTTTCAAGTGTGATACTTCTTTCT
TGTCAATGTAAAAGGAAACAAATACTGGATTTTTGTCCAGAAAATGTATGAGAGTCCAAA
CATTTGGATGGAAAGGCACATTTTTTTTCACCTTGCTTTGATTGGATAAAC