Microarray Probes on PGSC0003DMT400080788

Probe IDChipProbe Sequence
CUST_4017_PI426222305 JHI_St_60k_v1 AAGTTTTATTCAAGGGCATCAAGCTTTAGTAGGGAAACGCAAGTGCCATGTTCTATCTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400080788

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400080788 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G13600.1 +1 0.0 598 338/594 (57%) calmodulin-binding family protein | chr3:4445102-4447383 FORWARD LENGTH=605

Transcript Sequence (1638 bp)

>PGSC0003DMT400080788 1638 pgsc_dm_v3.4
ATGGGGATATCGTTTTCGTGTCCACTTGCTTCTCATACTGATTTGGAAAACAGTCTTGAA
TCTGTTATTGTGAAGTCTATCAACTTTGGTGATAATGAGCACAAGACGCCATTACGATCT
ATTAGTTTCAAAATCCAAGATTCTGAACCTATAGTAATGCAATCAGATGGTTCAGGAAAT
ATGCTCATAGAAAAATCTGTCATCTCAAGGACAAAGGAAAATGTAGTTGCCTATCCATCT
TCAGATAACATGATGAATCAACAAAGTACGAAATCGCCTTTGTTGGATAGTAGCAGCAGC
CCGAAACATGAGGCAGCTGTAAAGTTGCAGAAAGTATACAAGAGCTTTCGAACAAGACGA
AAATTAGCAGATTGTGCTGTACTCATTGAGCAGAGTTGGTGGAAACTATTAGATTTTGCA
GAACTCAAACATAGTTCTATTTCATTTTTTGATCTTGAGAAGCACGAAACAGCAATTTCG
CGCTGGTCAAGAGCGAGAACTAGAGCTGCCAAGATCGATCCACGACATCGTTATGGACAC
AACTTGCATTTCTATTATGTTCAATGGTTGCATTCTCAAAATAAAGAGCCATTCTTCTAC
TGGTTGGATATTGGAGAAGGAAAAGAAGTTAATCTTGTTGACAAATGTCCGCGATGGAAA
CTTCAGCAACAATGCATCAAGTACCTTGGTCCTATGGAAAGAAAGGCTTATGAGGTCATA
GTGGACGACGGGAATCTCTTCTACAAAGAGACTGGGAAGCTCCTTGACACCACTGGTGAA
CCAAAAGGAGCTAAATGGATATTTGTCCTCAGCACATCGAAAACCTTATATGTTGGGAAG
AAAAAGAAAGGAACATTTCAGCATTCCAGTTTCTTGGCTGGGGGCGCGACTTTAGCTGCT
GGCAGGATAGTTGTGGAACAAGGAGTTTTGAAGGCTGTCTGGCCTCACAGTGGACATTAT
CGACCTACTCCAGAAAACTTTCAAGACTTCATTTCGTTTCTTAGGGAGAACGATGTGGAC
TTAAGCGATGTTAAGCTTGATTCTATCGACGAAGAAGATTTTATTGGGAAGAAGAGTGGT
GTTTACCTTAGAGGTAATGCTTCGGATGATGACATAGGTCAAAAAGATGGTCTGGAGACA
GGAGAGAACGATTTAGAAGACGTAACGACTTCAGATACAAATGAGTTGAAAGAACAAGCA
ACTTTTGCTGCTTCATCTCATAGCTTCAATGACAAACTAGCTAATCTACGAATTCCTAGC
AACGATGATTTACTAGAGAGATTGACGAATGAAAGTGTAGCTGTTGAATCCATTTCGCCA
ACAGATGGATATGAATCAGCAGAAGATTCAATTGCTTTTGAACAAGAAAGTAAAGGAGAT
ACAATTCCACAAGAATCTATACTGAAGAGGATAAATTCACACAAGGGAATGAAGTCATTT
CAATTAGGGAAACAATTGTCTTGTAAATGGAGTACTGGAGCTGGACCTCGAATCGGATGC
TTGAGAGATTACCCTCCGCAACTGCAATCACATGCATTAGAAGAAGCTAACTTGTCCCCG
AGGAGTGCTTGTCGTCTCAAGTTTTATTCAAGGGCATCAAGCTTTAGTAGGGAAACGCAA
GTGCCATGTTCTATCTAA