Microarray Probes on PGSC0003DMT400080723

Probe IDChipProbe Sequence
CUST_51719_PI426222305 JHI_St_60k_v1 GAGCTTATTGTATGTCCTCAATGCAATCACGAACCAAAATGATTCAATGAATACACAAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400080723

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400080723 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G58770.1 +2 2e-67 219 125/238 (53%) Undecaprenyl pyrophosphate synthetase family protein | chr5:23734396-23735495 FORWARD LENGTH=310

Transcript Sequence (1162 bp)

>PGSC0003DMT400080723 1162 pgsc_dm_v3.4
TGAAAATTAAATGAGTTCTTTGTTAGTACTGCCCCAAGCCCAGTTCTTCCCAGTATCATG
TAATTTGGATTGTCGTCTTCTATCGACGAATTCATCAGATATATTTAGGTATGGCCATTT
CTCCAAGAGTTTGAGGCATGATGATCAATCTGTTCATCCAGAATTTACCCCTAAACACGT
CGCTATAATAATGGATGGGAACAGAAGATGGGCTAAAGCTAGAGGATTACCTGTGCAAGA
GGGTCACAAATTTATTACTCCTAATCTTAAGAATATTTGTAATGTTTCTACCAAACTTGG
AATACAAGTTATCACTGCTTTTGCTTTCTCTACTGAAAACTGGAATCGTTCTAAGGAGGA
GGTTGATTTTTTGATGAAACTGTTTGAACAGTTCTTTGAAGAATTTATGAGGTTTGGTGG
AGTACGGGTGTCTGTTATTGGAGGTAGATCCAGACTTCCGATAAAATTACAGAAAGGCAT
AGAGTTAACAGAAGAGGCGACCAAAGGCAATGAAGGACTTCATCTTACGATGGCACTAAA
CTATGGAGGAAAACATGACATGTTACAAGCAACCAAGAGCATTGCCAGTAAAGTGAAGGA
TGGTCTTATTAATTTAGAGGATATCAACAACAAATTATTTGAGCAAGAACTCGCTACCAA
GTGTGCTAAAACACCTGATTTAGTCATAAGAACTGGGGGAGAACAGAGGCTCAGTAACTT
CTTATTGTAGGAGCTAGCTTACTCTGAATTGTACTTTACAAAGACGCTGTTTCCTGATTT
TGGAGAAGAACCTTTCAAGGACGCCATACTTTCCTTTCAGCAAAGACACAGACGTTTTGG
TGGACACACATATTGATGTTATTTCCTAATTCTCTTATTGTATGTGTGTTAGTATTTCGT
GATCTGCAATATCCTCTCAAAGTGTAAGATTTTCAAAATGAAATGGACAGACAAATCTCA
ATAGGCTAGAGAATTACCCATATTTGCACATCCCTTTGGACATAAATCAAATGACATCAC
TGTCATATCTAGAACTGATTTTTTTCTTCTCTTTTTTTTTTTTGGTTTGAAAAGTTCATG
TTTGGAGCTTATTGTATGTCCTCAATGCAATCACGAACCAAAATGATTCAATGAATACAC
AAACATGCAATTTATCTTGTTT