Microarray Probes on PGSC0003DMT400080576

Probe IDChipProbe Sequence
CUST_29447_PI426222305 JHI_St_60k_v1 ATGTTCAGAGAGTTGAGATAAAGCAATTCTCACTGGGGGATGAGCCTCTCTCTGTTAGGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400080576

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400080576 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G19830.1 +3 0.0 726 406/631 (64%) Calcium-dependent lipid-binding (CaLB domain) family protein | chr3:6886338-6889974 REVERSE LENGTH=693

Transcript Sequence (3096 bp)

>PGSC0003DMT400080576 3096 pgsc_dm_v3.4
GGTGGGTGGTGCTTTCACACATAGAGGTGGTGTGTTTTCCCTTTGCCAAAATTGCTGCAA
ATTTTTGCGGCCTTTAAACTTCCTCTGTGATTCCCTGTAATCATATAAGGATCAAATTCC
TGATTCCATATTTGTACCTTCCTTTTAGCCTTTTCACTTTCTCTCTCTATCTTTGTTTCT
CTCTCTAACACACGCAGAGAGTCTTTTGTACATGCATCCATGTGTGCTGAAAAAACTGGG
AATTTCATAGCTTGTAATGTTGTTTTCAGTTCTCTTTGAAAAAGATAAAGCTTTGAGCAA
TTTGGGTTTTGGGTTTGGATTCATGTTTATTGGTACTTCATTGTATACTTCAAGTTCAAG
AACTGTTAGTTATAGCTCAAAAGGCATCTGGGTTTTTGATATTAATGGTTTTTGATTCAG
TTTCTGCTATTACCCCTGATTTCCCTAACGTATTTTGGGTAAACCCATCTCCTTCTCCAT
GTAAAAGTAATGGCAATTCGTTGGTGACGAGGAGGAGGAGTAGGGGGAAATTGGGTTTGG
ATTCGAGTTGGAGGTATAGGATTCGTGCGAAATGGGCAATTCGAGCTTGTGTGAATGGTG
GAGACCACCATAATTTTGACATGCAGATTACGAATAGTGCTAGAAGAGGAGCTAGAAATA
TTGTAGTTAAGAGATTTGCTGATGAATTGGATGCTTATGGAAGAGTCTCTGAGGAATTAG
AAGCTGCTAGTCGTTCTAGTAACAATTTTGCTAGTTTTCAAGAAGACCCTTTTGTAGATA
AGCTAAGGACTCAATTGGGGGTGATGCATCCATTACCTTCACCTCCAATAAATCGAAATA
TTTTCGGTCTTTTTGCATTGTTTTTCTTTGTTGGTATTGTTTTTGATAAGGTTTGGACAT
CTAGAAAGAGTAATGCTAAGTCAAACAATGGAGGAAACTCCGGGATATGGTCACAGGTCC
CAGCAAACCTTTCTTCATTGTTGGAGAAGGATTTGCAAAGGAAAGAGTCAGTGGAGTGGG
TAAACATGGTGTTAGGGAAGTTGTGGAAGGTCTATAAACCTAGGATTGAGAATTGGATCA
TTGGTTTGCTTCAGCCTGTCATTGATAATCTCAAAAAGCCTGATTATGTTCAGAGAGTTG
AGATAAAGCAATTCTCACTGGGGGATGAGCCTCTCTCTGTTAGGAGCGTGGAGCGGAAAA
CTTCTCGTGGAGTCAATGATTTGCAGTATCAGATAGGTCTCCGATACACTGGTGGTGCTC
GCATGCTGTTAATGCTGTCACTAAAATTTGGAGTCATCCCCATTTCTGTGCCAGTCGGTG
TTCGGAACTTTGACATTGATGGTGAACTCTGGGTCAAGTTACGATTAATACAAACAGAGC
CTTGGATTGGAGCTGTTTCTTGGGCTTTTGTTTCCCTTCCCAAGATAAAGCTTGACTTGT
CACCATTCCGTTTGTTCAACCTAATGGCAATTCCTGTTCTATCAATGTTTTTGAAGAAAC
TTCTTACTGAGGATTTACCTCGTCTCTTTGTTCGTCCGAAAAAAATTGTGTTGGATTTTC
AGAAAGGGAAAACAGTCGGCCCTATTCCAAGTGATCCTAAGTCTGGTCAAAGTGAACAAC
TTAAGACTGGAGAAATGCAAGAAGGAAATAATGACTTTGCTGGAGAACTATCAGTGACTC
TTGTTGATGCAAGGAAACTCTCTTATATCATCTATGGAAAAACTGATCCATATGTTAATC
TAAGACTTGGAGATCAAGTAATACGCAGCAAAAGAAACAGTCAAACTACTGTTATTGGAC
CTCCTGGAGAGCCTATATGGAATCAGGATTTTCACATGTTTGTCACAAACCCCAGGGGAC
AAAAGCTATATATAGAAGCAAAGGATTCCTTTGGTTTTACAGATTTGACTATTGGCTCAG
GGGAGGTTGATCTGGTATCTCTCGAAGATACTGTACCGACAGACAAAATTGTGATCCTCC
GAGGTTGGGGACTACTGGGACCAAGGCCTGTAGGAGAGATTTTACTGCGACTGACATATA
AAGCTTACGTCGAAGATGAGGAGGACGAAAGGATTGAAGCAAGATCCAAGTATTTGGATG
CTTCAGATGATGAATCATCTGACTTGGATGAACGAGATACTGCTGTGTATGAGCAGCGTA
GTGGAACAGATAAAGAATCATTTATGGATTTATTAGCAGCATTAATTGTCAGCGAGGAAT
TCCAAGGGATCGTGGCATCTGAAACAGGCAATACTAAATCTGTAGATGATTTTAAAACTA
GAGTGTCAACATCAAGACAACGTACTCCTTCTAGGTCTGTACAGCAAACTTCTGATACTG
TTCCTGAAAACTTTGGAGAATCACCCCTGTTTTGGCTAGCGATTATTACAAGTATCTCAG
TTCTAATTGCTCTCAACGTCAGTGGTTCTAGCATTTTCAATCCATGAATAATGAAACAAA
ATAAGATTGATAGCTCCTGGTAAAGAATACAATATAGAGTTCCTGCTGGAATTATTCTGT
CAAACCACACATAGTTGTCACCACTCTGAGATTGCCCGAACGGAAACCTTATCAAAGTCC
TTACCTTCTGCCGGTCTTCCATTCGAGGCTGGGCAACTGCTTCCTCCATTATCTGTAAAC
TATTGTACACTCTTTAACATTTTAACCAGATCAACAACTCAAACCCTCCCCCCTCCCCTA
CCCCACAACTCCAATAGCAAATGATAGGAATCCCCAGACACAAAAAAGAGAAGAGAACAA
CAAAAAATATGTTACAATGAGGTATGTATATATTGGCGGCAGATTTTGGCCATCCTTGTT
CTCTTGGTATTTGTTACATCCCGTGAATTCTAAGTCTCTCTCTCCGTGTGTGTATGTGTG
TGCGCGTGTATGCCAACTGTCGTAGCTATAGCAGCACAATGAGGTTTTTGACATTCAATC
GCGAGGGTGTACTAAGCCGTTGAAACTAGTGAAATACACCTTTCTTTTTCTTCATTGTTG
AAGTGGTAAGTGAAAGGGCGCTGGCATTACTAAAAGACGTTACTGTCAGTGTCGCGTATT
TACGTAGCTGTAGAGTATTTCAACATCCCGTTATCG