Microarray Probes on PGSC0003DMT400080505

Probe IDChipProbe Sequence
CUST_29742_PI426222305 JHI_St_60k_v1 GTACATCAACCAAAAAGCTTCGCCTTAGGGTTGATTAAATAATTTTATGCGACAACTTCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400080505

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400080505 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G41190.1 +2 1e-11 66 42/66 (64%) Transmembrane amino acid transporter family protein | chr2:17167561-17170145 REVERSE LENGTH=536

Transcript Sequence (1106 bp)

>PGSC0003DMT400080505 1106 pgsc_dm_v3.4
ATTAGCTGTATGAAGCGTTCTGATCTGGGTTCTTTACAATTTTGTTGAAAACAAGCTGAC
ACGAAGATTCAGCATTGCTGGTTAAATAAGAAGCTATTATAGATAGGATAAGGATGACGT
AAATATGGAGGTTCAGAAAAAAATGGTTTTGATGTTATATTAAGCACATATATTGCCCAT
AACAACCGGAATAATTTGCTTGGATGTTTTTGGTTGTGCTTGCACCATTTTAAATCCATT
AAGATATGGATTGCATTTGGAATAACAAAGTAATATGGAGAGTTTAAGCTGTGATGGAAG
CTGTTCCTCTGTGAATTGCATTCCTAAAGCACCAAATTCGTACATCAACCAAAAAGCTTC
GCCTTAGGGTTGATTAAATAATTTTATGCGACAACTTCTAATTATACAGTGATAAATCAT
CTTTGTTCCAGGTCTTGTGATGGCTCTGATTGGTTCTCTTCTCAGTATACTGGTGTCTGT
AATAATGCCAGCTTTATGTTACCTAAAGATCATCGGAAAGAAAGCAACAAGGACACAGAG
GGTGTTTAGCATCACTGTTATTGCAGTTGGCATTGTAAGTGCTGCTCTTGGAACTTACTC
CTCACTGTCAGGAATCGCAAACAAGTATTGAAGTAAAGCCTAACCACACACACCCCAGAC
CCCCTTTTCTTTAGGGTGGGGGTGGACATGTTTGCCATAAAACATTCTTATTTACTGTCC
TGTACTTTTGATCTCTTTCCCAAATATTATCCATCTTCTTCTCAGTTTCACTTCATAGTA
ACTTTACGACCCCCTATTGCTTTATAATTATGGGGTATCTTTCTCAGTGTGTATTAGCTG
CTAGTGTTTCAAGTAGAAAGTATCTGTTGCATTATAGAGTAAACAACATAAACTAGGATG
TTGAGTTGATCAAAATAATCTTATGAGACGTTGTAAAATATGTACATGGTATATATCTGT
ACTTGTGCTGAGGGTAAAAACCCTATATGGTAAGGACATAATTAATTAGTTTATAGTTTT
CTATTTTTCATGTACTCGCATCAAGTGAACGAAATGACGGATGTGAGTTGTCAATAAATA
AATTATAAACATTACTTGGGAGAAAA