Microarray Probes on PGSC0003DMT400080130

Probe IDChipProbe Sequence
CUST_50245_PI426222305 JHI_St_60k_v1 GCCCTTCACAATCTTTGCCTTTAGAACCTCTTAAACGTGTCAGTAAATTTCAGTTATATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400080130

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400080130 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G64810.1 +1 2e-17 76 32/46 (70%) WRKY DNA-binding protein 51 | chr5:25908415-25909687 FORWARD LENGTH=194

Transcript Sequence (393 bp)

>PGSC0003DMT400080130 393 pgsc_dm_v3.4
TAAAAGTTGAGTTGATTATCATAAAAAATAATTAATAGAGAAATATTTATGAACGGGAAT
TACTACAAATGTTCAAGTGGAGGATGCAATGTGAAGAAAAGAGTAGAAAGGGACAATGAA
GATTCAAGCTATGTCATTACTACTTATGAAGGGATTCACAACCATGAGAGTCCTTATGTG
TTTCACTACACACAATTCCCTCCCAACAATATTGCCCTTCACAATCTTTGCCTTTAGAAC
CTCTTAAACGTGTCAGTAAATTTCAGTTATATATTTGTATAATGGTAGGTTCTAATAGAG
CACTTTGATCATATGATAAAGTGTTTCTATTAAACATTTTCGACTTATGTTTTAAAAAAA
TGTGTGCACGTGTTTTCAAGTGCCCGATATATA