Microarray Probes on PGSC0003DMT400080116

Probe IDChipProbe Sequence
CUST_50241_PI426222305 JHI_St_60k_v1 GCTAAAACAATTCACGTTTCTCATGAATCAGTATTTCCTATAGATACTCGACTCACGTAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400080116

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400080116 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G13700.1 +1 0.0 709 326/435 (75%) purple acid phosphatase 23 | chr4:7957072-7958919 REVERSE LENGTH=458

Transcript Sequence (2404 bp)

>PGSC0003DMT400080116 2404 pgsc_dm_v3.4
GGCTCAAGTGTTCCAACCAACATAAGAAACACATGAATGCTTTGTTAAACTAAATTCCAG
TTTTGAGAGATGAAGAAAATTTGTACTACACTTTGGTTACAATTTTTTGTTGTAATTATA
GTTGCTAAGAGAATACCAACAACATTGGATGGACCATTTAAGCCACTAACTCATAGATTT
GATCCTTTATTGCATAAAGGAAGTGATGATTTGCCAATGGATCATCCAAGGCTTAAGAGG
AATGTAATTTCATTTTTTCCAGAACAAATTGCTCTTGCTTTGTCAACTACTTCATCTTTA
ATGTGGATTTCTTGGATCACTGGTGAAGCTCAGATTGGTCTAAACGTGACTCCACACGAT
CCGAAAACAGTGGCGAGTGAGGTATGGTATGGGAAGGAAAGTGGGAAGTACACAATGAAG
CAAAATGGAGTTTCAGTTGTTTACAGTCAATTGTATCCCTTTGAAGGGCTATGGAACTAC
ACTTCTGGCATCATTCATCATGTGAAGATTGATGGTCTTGAACCTGAAACAAAGTATTAC
TACAAGTGTGGTGATAGTTCTTTAGTAGCAATGAGTGATGAACTTGCATTTGAGACCTTT
CCATTGCCTGCACCTAACAAGTATCCACGACGAATAGCAGTTGTTGGTGACTTAGGTCTT
ACAAGCAATACAACCACAACAATTGATCATCTCATAATGAATGATCCTTCCATGATATTG
ATGGTTGGAGATTTAACTTACGCGAATCAATACCTTACCACTGGTGGTAAAGGAGCTTCA
TGCTATTCTTGTCAGTTTCCAGATGCACCGATAAGAGAAACATTTCAACCTCGATGGGAT
GGATGGGGAAGGTTTATGGAGCCGTTAATCTCAAGAGTTCCAATGATGGTTATCGAAGGA
AACCATGAGATCGAACCTCAAGCAGCAGGGCTCATATTCCAATCGTATTTGACAAGATAT
TCTGTTCCTTCAAAGGAATCTGGCTCTAATAGTAACCTTTACTACTCTTTTAATGCCGGA
GGAATCCATTTCATCATGCTAGGAGCTTACGTTGACTATAATCAGACGAGTGCTCAGTAT
TCTTGGCTTCAGCATGATCTGGAAAAAGTAGATCGTGGCGTGACTCCTTGGCTGGTGGCT
GCATGGCATTCTCCTTGGTACAATAGCTATTCATCACACTACCAAGAATTTGAGTGCATG
AGGCAGGAAATGGAAGAAATGCTATATACATATCGCGTTGATATAGTTTTCTCCGGTCAT
GTACATGCATATGAGCGAATGAATCGAGTCTACAACTATACTTTGGATCCATGTGGTCCT
GTTTACATAACAGTCGGAGATGGTGGTAATATTGAGAAAGTTGACGCTGATCATGCAGAT
GATCCTGGGAAATGTCCTTCACCAGGTGACAACATTCCAGAATTTGGAGGTGTATGTCAC
ATGAACTTTAGCAGTGGACCTGCCAAAGGAAAATTTTGCTGGGATAGACAACCAGAATGG
AGTGCATATAGAGAGAGCAGCTTCGGGCACGGGATACTGGAGATGGTAAATTCAACTCAT
GCGTTGTGGACTTGGCACCGCAATCAGGATATTTATCGTGAAAACAGTCATGGTGATCAA
TTATACATAGTACGACAACCTCATACTTGCTCTGTTGACTCAAAGACAGGATAGCAGGTT
GAGTCCATCAATACCAGTGGCGTTGGAACATTGAAGCTGCACGAGTATCCTATTTGTTAC
ATAATTTTCCTCATTGGCAACCATTGAGTACTCAATTGGACACACCTTTGTAATGTGTTT
ATTTTTAAATATCTAGGACACACCTACAATATGTGTAATGTTGTTTATAACAATAGGTAA
ATCACAAATGCCCGTCTAGCTCAGTTGGTAGAGCGCAAGGCTCTTAACCTTGTGGTCGTG
GGTTCGAGCCCCACGGTGGGCGTTAAACATATCAATTTTTTGTTGGAGTATCCCAATGGT
GTAACGCCGTCGACTTCTTGGGAAAAAGGAGGAAGATGACTTTAATCTCTTGTTTCGGAG
AAATAAGTGGCTCACGAGGAATGGAAAGAAACATATATTTCAATCCCATGTAATACCGTA
GTGGCTAAAACAATTCACGTTTCTCATGAATCAGTATTTCCTATAGATACTCGACTCACG
TAAAAACATATCAAAATTAGCTATAACTGAAGAGTGAAACTATGAAATCATGAACATACT
CCATGATATTCATGCTTTAATAATCCTTGAGAAAACCTTGTCATAAATTTTATAGCATGT
CTAGATTACTATATTGTTCTTTATATCAAAAAAATACCCAAGTTTGTAGGGAGCTGTATT
TAAATTGAGCAATTTATTTAATTGTTATTAAAAAAATATGCACATTATATTGTAACACCG
TCTC