Microarray Probes on PGSC0003DMT400079878

Probe IDChipProbe Sequence
CUST_36365_PI426222305 JHI_St_60k_v1 CGCGGTTTGTATGATCCAATGGCAGCTACTTGTACTATAATACAAGTAAAAATAGTAATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400079878

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400079878 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G17670.1 +1 2e-112 339 193/283 (68%) alpha/beta-Hydrolases superfamily protein | chr5:5821082-5822600 FORWARD LENGTH=309

Transcript Sequence (1523 bp)

>PGSC0003DMT400079878 1523 pgsc_dm_v3.4
GTTTTAGTGGTCTTACAGTCGAGTCGTGCTTATGCCATTGCAAGTTTGGTGTTATTTTCT
GTGGAACACAAAGTTAAACTCAGATTATACAAGTGTAGCATATTTTTATGACAGACAAAG
CAAGAAAGAGTCGTGGAAATATGAGCACCACAAATAAAATAGAATAGTTAGTTAAAGTTT
GTGGGATGGAGAAGGCAAGTGGAGTGGGGGGAAATGGCTATGAGTGTAGTAGCATGGTTG
TCACCATGCACCACTATTTCATCACCAAACAAATTCAGCTGCTGCTCTGCCATTTCTTCT
CAAGCTGAATCTTCCTTCACAACAGCTACTGCAACCGCCATTCGTCCTGCTGTTATTCTT
CCGGGTTTAGGGAACAATTCAAATGACTATGAGAAGCTGGCTCTCATACTGAAAGGATAT
GGAGTACCAACAGCAATAGCAAAAGTTTCAAGAATTGATTGGCTTAGGAATGCTGCTGGT
TTGTTGGACACAAATTATTGGCGTGGCACTCTCCAGCCTCGACCAGTGCTTGACTGGTAC
CTCAAAAGAATTGATGAAGCCGTCAGTGAAGCAAAAGAATTGGCTCAAGGTGGGAGTGGA
TCTTTATCTATTATTGGGCATTCAGCTGGAGGGTGGCTCGCACGTGTCTATTTGCAGGAA
TTCGGCTCCTCAGACATTTCCTTGTTACTGACTCTAGGAACCCCCCACCTGCCACCACCT
AAAGGTTTGCCAGGTGTAATTGATCAGACAAGAGGCCTGTTGTATTACGTTGAAAAGAAT
TGCGCAAAAGCTGTCTATTCTCCAGAACTTAGATATGTATGTATAGCAGGGAGGTATATT
CAAGGGTCGCGTTTCTTTGATTCAAGTTCAACACACAGCTCTGAATTCGTGGACGGTGCT
GAACAGCCAATGTCAGAGGTTGCTGCTGTAAGCAACACAAATGCAGAGATTGAAACAGGC
TCCACTTTTCGTACACGGTTTGTTGGTCAAGGCTACAAGCAGGTTTGTGGCCAGGCAGAT
GTCTGGGGTGATGGAGTTGTACCAGAAGTTTCAGCCCATCTGAAAGGTGCACTTAATGTC
ACTCTGGAAGGAGTTTACCATTCACCTGTTGGTTCTGATGATGCTACAAGACCATGGTAT
GGTTCTCCTGCTGTTGTCGAACAATGGATTCGACACCTGCTTGTCTGACTGTATAGTTTA
AAAGACAGCCTGGTGAAAGCATTCCTCATTAGCAAGATCTGGGGAAGGGCGACTGTGTAA
TTCCATGGTAAATATTGGGCAAATTTGCCTTATTCTTTGTGGCAAATGGAGAACATTGTT
CATAAAAATGTCACATCTGAGCCAATTAATGAAATCTTCTTCATGAGTATTATGAGATCC
CCTATGCTCATTGTTTTGTCTCTCATTCTTAATCAGGACTAGGATTTAAGGACTCGCATT
CCAGATTTTTGCGCGGTTTGTATGATCCAATGGCAGCTACTTGTACTATAATACAAGTAA
AAATAGTAATGAAGCTGGAAAAG