Microarray Probes on PGSC0003DMT400079638

Probe IDChipProbe Sequence
CUST_18623_PI426222305 JHI_St_60k_v1 AAGGATGAAGCAAAAGTGGTCGACTCTGTTCTCGTCACTGAACTCTCTAAGCCTCTTACT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400079638

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400079638 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G51720.1 +1 2e-37 129 69/108 (64%) 2 iron, 2 sulfur cluster binding | chr5:21009645-21010227 FORWARD LENGTH=108

Transcript Sequence (696 bp)

>PGSC0003DMT400079638 696 pgsc_dm_v3.4
AGAAATCACAAATTTAGGAACGTGGATATTGTAGCTTCCACTCGATTTGGGGAAAATCAA
AATTCACAAGGGAGGACCGTGCTCGCCACACGTTCGTCACCCCTTTCTCTTCTCCTTTTA
TTTAGGCATCAACTCATTCCCAAATAATAATAACAGAGAACATCAATGGCGTCTACAGCT
AGCATAATTCAATCTGGCTTCTCATGCGGCGGCGCATTAGCTTCCTTCACCGCGAAGCCA
AGGCGTATGGTGGTGGTTCGTGCCCAAGCTATAAACCCAGACATTAAGAAGGATGAAGCA
AAAGTGGTCGACTCTGTTCTCGTCACTGAACTCTCTAAGCCTCTTACTGCTTACTGCAGG
TGTTGGAGGTCTGGGACTTTTCCTCTATGTGATGGAAGCCATGTGAAGCACAATAAGGAA
ACCGGAGATAACGTTGGACCCCTGCTATTGAAGAAGCAGTAAGTGGTTATGGTATCGTGT
TAGTCTCTAGATTGTGCAAGCTCTTGAAGCTTATTTCCCTAGTGTCTTTTTGCTCTATCT
ACCATTTGTTGAACGAGATATTGTTCTTTCCCGGTGAATGTTCTTTCTAGAATAAATTAA
AACCGATTTAAACTGAAAGTAGTTGCAATATTTATCCTACTTTTCCAGCAGTAGTTATTC
TCATGCTACAACTCGATCACATAATCACAGAAACCT