Microarray Probes on PGSC0003DMT400079633

Probe IDChipProbe Sequence
CUST_18628_PI426222305 JHI_St_60k_v1 GCCTTGTTTGAGTGTACCAACTTCAACAACTTCTTGAATTTGAAGCATTCAAGTAATTAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400079633

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400079633 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G51670.1 +2 7e-152 449 254/479 (53%) Protein of unknown function (DUF668) | chr5:20993560-20995096 FORWARD LENGTH=474

Transcript Sequence (1728 bp)

>PGSC0003DMT400079633 1728 pgsc_dm_v3.4
ATCTAATCCTCTCTCTCTCTCTGTTTCTTTCTCTTTGTTTTTCTCTCAACTTTTTTCTCA
TTAAACTCATCAATCAATCTTCTTCTTCTTTACTCAAAAACTCAATTTACATTATTCGAT
TCTCAAATTCTAAATCATGGCGCTGGAAACATGGTTGAATAAGGTGAAAAAAACGATAGC
ACACAGCTTTGTTACAGTAAGATCAGCCGGTGCGCCACGTGCAAAGACGGCGGTGATCAA
GAAATCCAGTGTTGGGGTTTTAGCATTTGAGATCTCTGGGTTGATGTCAAAGCTACTCCA
TTTATGGCAATTTTTATCTGAGAAAAATATGATAAGAATTCGTAATGAGTCGATATGCCT
AGAAGGTGTTCGTAAAATTGTCTCAAACGATGATGCTTTTCTTATAGGCCTTGCTTGTGC
GGAGATTGTGGAGAATTTAAGGATGGTTGCGAAATCTTTGTCAAGAATCAGCAAGAGATG
TGAAGATTCACATCTCAGAAGCTTTGATCGATTCTTTACTGAATTCGCAAATATGGGTCG
TGATCCTTATAATTGGGTTCTTAGTTTGAAGGATATGGAGTTAAAAATCAAGAAAATGGA
TCAGTTTGTCACTACAACTGCCCTGCTTCATCGACAAATGGATGAGCTTTCAGTACTTGA
GAATAGTTTAAAGAAAGCTTCGAATTCAAGTTCCCATTTCAAAGATTCTGACATTTCAAT
CAAAGAACAGAAGATACTTGAGCTACGACAGAAGTATCTGTGGCAGAAACAAGAAGTTAA
GTATCTAAAAGAGCGATCTTTATGGTGTCGTAGCTTTGATACAGTTACATCATTGTTGGC
TCGATCCATTTTCACTACACTAGCAAGGATCAAGCTTGTTTTTGGTATCAATCATGGATA
TCCAAATTCACTCCCACGTAGTCTCTCTGCTTCAGCCACTGTTTATCCTTCAGAAAATCA
TAACACATGCAATTTCGTCTCCGGGCCATTGATGAACAATCCCCCTATACTGAAAGTCTC
AGATCATGAATTTTTCGAGTCAAATACTAAGGTACTTAAACCACCTACGAGTACTTTAGG
CGCGGCTGCACTTGCTCTACATTATGCTAATTTGATCATTGTTATGGAAAAAATGATAAG
ATCACCTCAACTAGTTGGGGTTGATGCTAGAGATGATTTATACTCCATGTTACCAAATAG
CGTTCGATCATCATTAAGATCAAGACTAAAAGGAGTTGGATTTTCGGCTAGTGATCCAGT
TCTTGCTGGTGAATGGAAAGATGCCCTACAAAAGATTTTAGGATGGTTGTCACCTTTGGC
ACATAACATGATCAAATGGCAAAGTGAAAGGAGCTTTGAACAACAAAATTTAGTTCCAAA
AACTAATGTTCTCTTGCTGCAGACTTTGTATTTTGCAAATCAAGAAAAGACTGAAGCTGC
CATAACAGAGCTGTTAGTTGGTCTAAACTATATTTGGAGGTTTGAAAGAGAAATGAATGC
TAAGGCCTTGTTTGAGTGTACCAACTTCAACAACTTCTTGAATTTGAAGCATTCAAGTAA
TTAGTCTTTTCTTGTTTGTTCTAAGTTTTTTTTTTTATTCTTCTTTGTTCTAATTAATAG
ATATATAATTTGAGGATTGTTAGATGTAAGGTCTGTTTTGTTTTAACACAAATCTGTATA
TTGTATCATATCAATTGTAGACTATTACTATAAGATTTGAGTCAAGAT