Microarray Probes on PGSC0003DMT400079558

Probe IDChipProbe Sequence
CUST_47027_PI426222305 JHI_St_60k_v1 GTAGCCCCTATGTTCACTTTTATTCATCCACAAAGGATTTTGCACTCTTTGTAAGAAATA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400079558

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400079558 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G70370.1 +3 0.0 696 339/599 (57%) polygalacturonase 2 | chr1:26513003-26514998 REVERSE LENGTH=626

Transcript Sequence (2088 bp)

>PGSC0003DMT400079558 2088 pgsc_dm_v3.4
ACACTCTCTCTTTTCACACTAAAGCAATGCATACCAAAACTTTTCTTTCTTCATGCATCG
TACTTTTTCTTTTGTTCTCACTTTCATCTTTCAATGTTGTTGTGGCTAGAAATGGAGACA
AATCCGGGAACCCATTTACGCCAAAAGGTTATCTGATTAGATACTGGAGTAAACATGTGT
CAAATGACTTACCAAAGCCATGGTTCCTTCTCAACAAGGCATCTCCATTGAGTGCTGCTC
AATATGCAACTTACTCAAAACTTGTTACTGATCAAAATGCACTGACCACACAACTTCAAT
CCTTTTGCTCTTCAGCAAATCTCATGTGCGCACCAGATTTGTCACCAAGTCTCGAAAAAC
ACACAGGAGATATCCACTTTGCCTCTTACGGTGACAAGAACTTTACCAATTACGGCACCA
AAGAATCTGGTGTCGGATTCAACTCCTTCAAGAACTATTCTGATGAAGGAAATTTCCCTG
TGAATTCTTTCAGGCGCTACAGTAGAGATTCTCCCCATGATAATCAATTTGACAACTATG
CCCCTGATGGCAATGTACCTGACCAAAGTTTCAACAGCTATAGCAAAAATACTCCAGGGG
GCTCTGGCCAATTCAATAATTACGACCCAAATAGCAATGTTGCCAATATGGGGTTCAATT
CCTATGCTGACAATGGAGCTGGTTCGGTCCAAAAATTCACAAATTACGCCCCAAGTGGGT
CTAATATCCCTAATATGCACTTCACTTCTTATTCCGACCACGGAACGGGAGGGGAAGAAG
AATTCAAATCCTACTCAGACGATGCAAATGGTGGAGTCCAATCTTTCAAAAACTATGGCA
AAGATGGGAATGGTCCTAATGGTAAATTCATCGAGTATGGAAACAAAGCCAATGATCCTC
AAAACAATTTCAACAACTATGGCGTTGAAGGTAATGGTATATCTGAGACTTTTACTAACT
ACAGAGATCAATCAACTCTTGGCGATGACAAGTTCACCGTCTATGTTAAGGACGCAAATG
GTGGTGAAGCAAATTTCACCAACTATGGTCAATCTACCGATGAATTTGATAACGGTACTG
ATGAATTCACTACCTATGGCGAAGGGGGTAATGACCCACATATTAATTTCAAAACTTACG
GAGTTAACAACAACTTCAAAGGTTATGTCAAAGACACTGCCACATTTTCCAATTACCGAA
AGAAAACTCCCCAAGTTTCGGCTTCATTGACCGGTGGCAAAAAGGTGAATAACCGGTGGG
TTGAGCCCGGAAAGTTTTTCCGGGAGAAGATGTTGAAGAGTGGTACAATCATGCCTATGC
CAGATATTAAGGATAAGATGCCTAAAAGGTCATTTTTGCCCCGGGTGATTGCTGCGAAAT
TACCCTTTTCTACCTCAAAGATTGATGAGCTGAAGAAAATCTTCCATGCCGCCAATGATT
CTCAGGTGGCAAAGATTATCGGCGATGCTCTCAGTGAATGTGAAAGAGCACCGAGCGCCG
GCGAGACGAAACGGTGTGCTAAGTCAGCTGAAGATATGATTGATTTCGCAACATCAGTAT
TGGGTCGAAATGTGGTGGTTCGAACGACTGAGAATACAAAAGGATCAAATGGGAATATCA
TGATAGGAGCAGTCAAAGGAATCAACGGTGGAAAAGTTACAAAATCAGTATCATGTCACC
AGACCTTGTTCCCTTACTTACTGTATTACTGTCATTCGGTTCCTAAAGTCCGGGTCTATG
AAGCGGATATTTTGGACCCGAATTCAAAGGCTAATATCAATCACGGTGTTGCCATTTGCC
ACGTGGATACTTCTTTATGGGGACCCAAGCACGGAGCCTTCATTGCACTCGGGTCGGGAC
CCGGGAAAATAGAGGTTTGTCACTGGATCTTTGAGAATGACATGACTTGGGCAACTGCAG
ATTGAGCCAAGGAGTAAAACTTGGTTTTAATAAATATTCAAAGTTTCTATTGTTCTCTCT
ATATTTGGGCAAAGTAATGTAGCCCCTATGTTCACTTTTATTCATCCACAAAGGATTTTG
CACTCTTTGTAAGAAATAAATAAAATAAATAAGATGCATATTTTAATT