Microarray Probes on PGSC0003DMT400079495

Probe IDChipProbe Sequence
CUST_41352_PI426222305 JHI_St_60k_v1 CAAATGATGAAGAATGAGAAGCTATTTCAGACCCAAGGTGGTCATATCATTCTGTCTCAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400079495

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400079495 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G36360.1 +1 0.0 884 402/581 (69%) beta-galactosidase 3 | chr4:17176840-17181143 REVERSE LENGTH=856

Transcript Sequence (1740 bp)

>PGSC0003DMT400079495 1740 pgsc_dm_v3.4
ATGCAAAGATTCACCACGAAAATTGTCCAAATGATGAAGAATGAGAAGCTATTTCAGACC
CAAGGTGGTCATATCATTCTGTCTCAGATCGAGAACGAGTATGGGTTAGAAATAAAACAA
TATGGTGCTCCAGGTCATGCGTACATGACTTGGGCGGCTAAAATGGCTGTTGAAATGGGT
ACTGGGGTCCCATGGGTCATGTGCAAGGAGGATGATGCCCCTGATCCAGTGATAAACACC
TGCAATGGTTTTTATTGTGATTATTTTTCCCCTAACAAGCCTAACAAGCCAACGATATGG
ACAGAGGCATGGAGTGGCTGGTTTGATGATTTTGGCGGTCCAGTTCATCATCGACCAGTT
GAAGATTTGGCCTTTGCAGTTGCTCGGTTCATTCAAAAAGGTGGCTCTTTGGTGAATTAT
TATATGTATCATGGGGGAACCAACTTTGGAAGAACAGCTGGAGGGCCTTTTATCACTACC
AGCTATGACTATGATGCTCCTATTGATGAATATGGCTTGATTAGGCAGCCAAAGTATGAC
CATTTGAAGGAGCTTCATAAGGCTGTCAAGTTATGTGAACCAGCACTGATTTCTGCTGAT
CCTACCGTTACTGTCTTAGGGAACTATGAACAGGCACATGTATTTTCTTCCGGCTCTGGA
CATTGTGCTGCTTTTCTTGCAAATTACCATTTGAGTTCAACTGCAAGGGTGACATTTAGG
CACCAACATTACGATCTGCCACCTTGGTCAATAAGCATTCTTCCAGACTGTAAAAATGTT
GTATATAATACTGCCAGGGTTGGAGTTAAGACATCCACTGCACAAATGCTGCCCACAAAC
GTACAACTGCGCACTTGGGAAACATTTAGCGAGGATGTATCCACCATTGATGTGGATTCA
AAGCTCACTGTTGTTGGTCTCTTGGAGCAATTAAATGTTACCAGGGATATGAGTGACTAC
CTTTGGTACACCACTAGTGTTGAGATAAATTCAGCTGAATCATTTCTACATCAAGGGCAA
CATCTGACTCTTACTGTGCAGTCAGCAGGCCATGCCTTACATGTGTATATTAATGGACGG
CTTTCAGGTTCAGTTTATGGAAACCGAGAAAACCGAAGAGTTACATTTACAGGAGGTGTT
AACCTGCATGCTGGAATAAACAGAATTTCCCTACTCAGTGTAGCTGTTGGATTGCCGAAC
AACGGAGCACATTATGAGACATGGAGCGCAGGAGTCCTTGGGCCAGTCGTTCTTCATGGG
CTAGACAAGGGTCAAAGGGACTTATCATGGCAGAAATGGTCATATCAGGTGGGGTTGAGA
GGCGAGACCATGAACTTGGCTTCAAATGCAATTTCTGCTGCTGAATGGGTAGGAGGCTCT
TTGATAGCAAGGCAGCAACAACCTCTTACGTGGTACAAGGTATATTTCAATGCACCAGGA
GGAAGTGATCCATTAGCACTGGACATGGGTAGTATGGGAAAAGGTCAAGTATGGGTCAAT
GGACAGAGCATTGGAAGATACTGGACCGCTTATGCCACTGGTAACTGCAGTCCTTGTACT
TATGCAGCTACATACCGACAAGGAAAGTGCCAATCTGGTTGTGGCCAGCCAACTCAAAGA
TGGTACCACGTTCCTCGATCTTGGTTAAAGCCAACTGGGAACTTGCTGGTAGTTTTTGAG
GAGATAGGTGGGGATGCATCAAAGATTTCTCTTGTCAAAAGGTCAATTACATATGTATAG