Microarray Probes on PGSC0003DMT400079161

Probe IDChipProbe Sequence
CUST_42492_PI426222305 JHI_St_60k_v1 ATGTAATGAGAGTTTGGTGAGACTAAGCAATAAAGCAAGGAAGTTACTCTTATATCTGTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400079161

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400079161 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G22410.1 +1 0.0 821 398/449 (89%) Class-II DAHP synthetase family protein | chr1:7912120-7914742 FORWARD LENGTH=527

Transcript Sequence (1933 bp)

>PGSC0003DMT400079161 1933 pgsc_dm_v3.4
TCAGGTACCCATCCATCTCTCTCTCCATAACAAAAGAGGTGCCCAAAAAGAGAAAATTAC
ACTTCATAAACTCTCACATTTGTGTTTCTTCACAAAATAGCAATGGCTCTTTCAAGTACT
AGCACTACCAACTCTCTTCTTTCCAACAAATCTTTGGTTCAAAATCAACCCCTTTTGCCT
TCTCCTTTAAAGAATGCATTTTTCTCCAACAACTCAACCAAAACCATTAGATTTGTTCAA
CCTATCTCAGCTGTTCATTCATCTGATTCTAACAAAAACCCCATTGTTTCCGATAAGCCC
TCCAAGTCTTCTCCACCGGCGGCCACTGCCACCACGGCTCCGGCTCCGGCTGTGACCAAA
ACTGAATGGGCTGTGGATAGCTGGAAATCTAAGAAGGCGCTTCAACTACCGGAATACCCA
AATCAAGAGGAGCTTAGATCTGTTCTTAAGACGATCGATGAGTTCCCTCCTATCGTCTTT
GCTGGTGAGGCTAGGAGCCTTGAAGAACGCCTTGGTGAGGCTGCTATGGGAAGGGCGTTT
TTGTTACAAGGAGGAGATTGTGCTGAGAGTTTCAAGGAATTCAATGCTAATAATATTAGG
GATACTTTCAGAATCCTCCTTCAAATGGGTGCTGTTCTTATGTTTGGCGGTCAGATGCCT
GTGATCAAGGTTGGAAGAATGGCTGGGCAATTTGCAAAGCCAAGATCAGATTCATTTGAG
GAGAAGGATGGTGTAAAGCTGCCGAGTTACAGGGGAGACAATGTCAACGGAGATGCATTT
GATGTCAAGTCCAGGACTCCTGACCCCCAGAGGCTGATCAGGGCCTATTGCCAATCTGCA
GCTACTTTGAATCTGTTGAGGGCTTTCGCTACTGGAGGATATGCTGCCATGCAGAGGATC
AATCAGTGGAACTTGGATTTCACAGAGCATAGTGAGCAGGGTGATAGGTACCGTGAACTA
GCTAGTAGAGTGGATGAGGCCCTTGGTTTCATGACTGCAGCTGGACTTACAATGGACCAT
CCTATTATGAAAACCACTGAGTTCTGGACATCTCATGAGTGCTTACTCTTGCCCTATGAG
CAGTCACTAACACGTCGGGATTCAACTTCTGGCCTTTACTATGATTGCTCTGCTCATTTC
CTTTGGGTTGGAGAGAGAACCAGGCAGTTGGATGGTGCCCATGTTGAGTTCTTGAGAGGA
ATTGCCAACCCTCTCGGTATTAAGGTGAGTGACAAGATGGACCCAAGTGCATTGGTCAAG
CTCATTGAGATTTTGAACCCACAAAACAAAGCTGGAAGGATTACAATAATTACCAGAATG
GGAGCAGAAAACATGAGGGTTAAACTTCCTCATCTTATCAGGGCAGTCCGAAGTGCAGGA
CAAATTGTGACTTGGGTATCTGATCCTATGCACGGAAATACCATCAAGGCTCCTTGTGGT
CTAAAAACTCGACCTTTTGATTCCATCAGGGCCGAGGTAAGAGCATTCTTTGATGTTCAT
GATCAAGAAGGAAGCCACCCAGGAGGAGTTCATCTGGAGATGACAGGCCAAAACGTCACA
GAGTGCATTGGTGGATCACGAACTGTGACCTTTGATGATCTGAGCTCACGTTACCACACC
CACTGTGATCCTAGGCTCAATGCATCTCAATCCCTTGAGCTCTCGTTCATTATCGCAGAA
CGTTTGAGGAAAAGGAGGCTCGGATCGCAAAGCGTTTTAGGGCAATAGATATTTGGAAAT
GTTCAAGTACTGCCTTTTTCTATTTACTTCTTCACTTATATTATGAATGTTTGTATTAAA
AATTGTATTTTCTTAAATCCTATTTGGAGGATATATGTTATGTTTGCGCTACGTGCATAC
TGAAATTGTTTTAATGTAATGAGAGTTTGGTGAGACTAAGCAATAAAGCAAGGAAGTTAC
TCTTATATCTGTC