Microarray Probes on PGSC0003DMT400078767

Probe IDChipProbe Sequence
CUST_33627_PI426222305 JHI_St_60k_v1 GACTTGTTGTTCTTCATCTTTGGTCCTCTGACTGTCTATTTAGCCAATTGATAAGAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078767

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078767 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G03341.1 +3 8e-38 128 55/71 (77%) unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr3:790338-790556 REVERSE LENGTH=72

Transcript Sequence (580 bp)

>PGSC0003DMT400078767 580 pgsc_dm_v3.4
TTAATACCCCAAATCTTCTTCTTCAAATTTTGTATCAATGCTCCTTTTAGTAAAATTTGT
GTGTAACATTGCAAAAATCGCAGACTTGTTGTTCTTCATCTTTGGTCCTCTGACTGTCTA
TTTAGCCAATTGATAAGAAAAAAATGGGTTTCGTTGGAGTTCCGATCTGTGTGCAGTGTG
GCAATGCTAGCAATCCTTGTAGGTGCAAGGTGGTGGGGCCAACACTTGGTTTCTTGGCAT
TTGCTGCGGCAGCAATTGTAGAATGGCCGGTTGGTGCTCTGGTTTATGTGTTCCGTCACT
CCAAGGGACGCCGGATTATGGGTCATCCAGCAACCGTCATTTATCCTTCAGTCACCAACT
CTATTCCTATTTAATTTTCCTTTCAACAAAGATCAGGTGCTTTGTTTGTAGCGTGACAAT
AATAATATATAATGTATGATGCTTTAAATAAGCATTAGTTTTTTTTTGTGTACTTGTATC
AAGTTTGGTTGGGGTTAAATAAGCTTGATGTGGATTGAATTATACTACATCTATAAAAGA
GCAGTCAGTACAGCATAAATAAGTAACATGTAGAATGAAG