Microarray Probes on PGSC0003DMT400078524

Probe IDChipProbe Sequence
CUST_11267_PI426222305 JHI_St_60k_v1 GTTGTGCAACATTCAACTGTCATAAGTTACTTTTTGACAAAACTGACGGTTTCTACATTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078524

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078524 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G01170.1 +2 0.0 592 301/388 (78%) bidirectional amino acid transporter 1 | chr2:102364-104462 REVERSE LENGTH=516

Transcript Sequence (2737 bp)

>PGSC0003DMT400078524 2737 pgsc_dm_v3.4
ATTTGGAGTTTATAGAATTTTGGAACAGTTAGAGGCAAGTTAGGACTTTGAGTTTATGAG
TTTATGAGTTCTGGATTCTAGGAAAGACAGTTTTCTGAGTTCTAAATAGTTTCACTTTCC
TTACAAGTATTCGTTGTGTTAATCAGTCAGCAGCCCGTTATCTAACAAGTTTTGAACCGT
GCGCGACTGGTCCTCAGGTTCTCAGATATCAAAGAGAAAAATTCAAGCACGGGACTGACA
TTCCACCCTTAGCTGGTGATATGTTAACCTGGATTAGCTTTTCGTATTGATTGAAGCTCA
AGCCTTTTGCATTAGCATGGTTTTATTAATCTTACAAGTATGTGAACTCGTATGTGAGCT
CCACATAACCGGTCCTAGTGTGGATAAAGGAGGAGAGTTACAGACTTACAGTAGGTTGAC
GGTCAACGTTAAATACTCAAATTATGAGAAATCCTTGTAGTAATGAATCCTCTATGTATT
GAAATGAAATAGGTCCAGATGGAGCCGAATACATAGAGGATTCATGTTTTTGACCCCTAC
TAGTTTGGGTTTTAGGCATATCTGGTTGATGCTGATTTGCTTAACCAACTGTGCATTTTG
GAGACAATAACTCGATCCATAGTTATGGCTTGATTTCAGCAAAAGACTGTTCTTCCGAAA
TTCGTAGTGTGAGAAATGCACAATCAGAATATGGTTTACTTTTGACGATCAGAATGAATG
TTCCTGAAAAATTGCAGCCGCGCTAGGACGACCTACATTGTCAATGAGTTCCTTAACTGT
ATGTGCGAGTTTCAGTTCAAGGCTGCTAGACATTAAGTTCCTTAGAAGTAATATATTCAT
TGGGTAGAGCAAACAAAAGAAGGTAAAACAGAAGGAAACACACACAAAAAAATGAAAATA
TTGAACTCTCTGGGTTGCGGACCTCTTTTTAATTCTTTACTTGGTACCTTTTATCATCTA
CTGACTTTCAATATTTTTTTTATTTATTTTTTTGATGACAAGGGAAACCCACAGCCGCTA
CCCTTTGAGTGCGCACAGGGTAAAACCCCCGTTCCTATGCAATAGCTATTGACTTTCAAT
ATTAGATTTAACAGAATATGAAATTATTGAACTATCTTCTGTTAGCTCATGTCTCTGTCA
GTTGTGCAACATTCAACTGTCATAAGTTACTTTTTGACAAAACTGACGGTTTCTACATTC
ATATTGCTTCTTTCTCAGTAAAATTTCTTTCCTTTTCATATTGCAGGTTCAACATTGTTG
GTCAGGTATCGTGAAGAATTACTCGTATTTCCATTCACAATTTTAGTGTCTAATTGGGCT
TAGCTGCTTCACCATATAAAACAACTCTAATCCACTACGGAAAATCTGATTGCAGTGGGC
TGTCACAACAAGTGTAGATTATTCATTGGCTCAGTTAGTTCAGGTGATAATTCTTCTTAG
CACTGGTGGATTAAATGGTGGCGGATATCAGGCCTCCAAATATGTGGTCATCGCCCTCCA
TGCTGTAATTCTGCTTTTACATGCTTTATTAAACAGTCTTCCGATTTCATGGTTGTCCTT
CATTGGGCAACTAGCTGCTGCATGGAATGTTTTAGGTGTCTTTCTTCTTATGATTTTGAT
CCCAATGGTCGCAACAGAAAGAGCTAGCGCTAAATTTGTGTTTACTAACTTCAATACTGT
CAATGAGGATGGAATCAACAATAAACTCTACATCTTCGTCCTCGGACTTCTCATGAGCCA
GTATACATTGACAGGTTATGACGCTTCTGCCCATATGACGGAAGAAACCAAAGATGCAGA
TAAGAATGGGCCAAAAGGAATTGTAAGTGCTATTGGCATATCAATTCTTGCTGGCTGGGC
TTACATACTTGGTATAACCTTTGCAGTTACAGATATCCCACATCTGTTAAATAAAAACAA
TGATTCTGGCGGCTATGCTATTGCTCAAATCTTTTATGATGTATTCAAGAGTAGATATGG
CAGTGGTGTTGGTGGAATTGTTTGCTTAGGTGTTATTGCTGTTGCCGTATTCTTTTGTGG
TATGAGCTCATTAACTAGCAACTCGAGGATGGCTTATGCATTCTCCCGAGATGGAGCAAT
GCCATATTCGTCGTTCTGGCATAAAGTAAACAAGCATGAGGTTCCGCTAAATGCAGTCTG
GACGTCAGCCTTTATAGCATTTTGCATGGCATTGACGTCTCTCGGAAGCTTGGTAGCATT
TCAAGCCATGACATCTATAGCGACAATCGGGCTTTACATTGCTTATGCCTTGCCAATCCT
GTTTCGAGTGACTCTAGCTCGAAAGTCCTTCACTCCAGGTCCTTTCAACTTGGGAAGCTA
CGGTATCGTTGTAGGTTGGGTTGCAGTATTCTGGGTCGCGCTCATCTCTGTGCTCTTCTC
TTTGCCTATTGCCTACCCTATTACAGATCAAACTCTCAACTATACTCCAGTCGCGGTCGG
TGGCCTTGTCATTCTTGTTGTTTCTTCATGGATCTTCAGTGCTAGGCATTGGTTTAAAGG
TCCTATTACCAATATAGGCAACTCTAGTGAAGAAGCATAAGTAGAGAGAATTCTTTTGTA
ATTACACAATGCTGATAGCGGATTCAAGATTTAAACTTTATGAATTCAAGATTCTACCAC
AACTCATTTTATTTGTGTAAAAAAAAATGGATTAAAAAATTGACACTAGAACAAAACTAA
GAATCCTACTTCTTAATATTTGGATTTTATTTTTTAA