Microarray Probes on PGSC0003DMT400078399

Probe IDChipProbe Sequence
CUST_11258_PI426222305 JHI_St_60k_v1 GGATTTACTTGCTTGGTTCTCGTTAAACTGAGTGTTAATGGTCGACGATGAAAATTAAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078399

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078399 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G15100.1 +3 2e-41 141 79/169 (47%) RING-H2 finger A2A | chr1:5193703-5194170 REVERSE LENGTH=155

Transcript Sequence (724 bp)

>PGSC0003DMT400078399 724 pgsc_dm_v3.4
GAAAAAAGTGTCAAGCAAATTCTAAAACCATAATAATAGTATTATCCCAAAATATGGGAT
TACAAAACCAGCTTAGTGACATTTCTACTGAATCAATTCCAATATTAATGATAACCCTTT
TTGCTAATTCTCTTAATTATCTCCGTTCCTTAATCTACACTTTCCTTCAATTTCTTGGCA
TCTCTTCTTCCCGATTTACCCCTCATCAAATCGACGATTCGTTCTGCGAAGCGGTCGGGT
CCGGTTTAACCGGCGTTATTTTCCTCGCCGATCAGCTTAATCTGAACCGGTTGTTATCTT
ATCATCATCAACAGCAACAGGATGAAAAAACCGGTTCCGGTTCAAGTACCTGTGTGGTTT
GCTTGAACCGGTTGGGTGATGGAGACCGGGTTCGCAAGTTAGCCTGCCGGCACGTGTTTC
ACATGGAGTGTTTAGATGGGTGGTTCAATACGCTAAATTTCAACTGTCCACTTTGCCGGT
CGACTTCGGTCTCCGGTGAGCGCGTGGTGAGAGCGCGGCGGCGCGTTGCTGGGGATTTAC
TTGCTTGGTTCTCGTTAAACTGAGTGTTAATGGTCGACGATGAAAATTAAACTTTTTTTC
TTTCTTTTTTTTATTTTTCTTTTCACTTTTGTGGGATTACTTTTAGTATTTTTTTTTTAG
GAAATTAATATTTTTTTCCTTTTTGTTTTGTTTTTGAAGGGCATTGATAAGAAGCTCTTT
TGTA