Microarray Probes on PGSC0003DMT400078243

Probe IDChipProbe Sequence
CUST_22827_PI426222305 JHI_St_60k_v1 CTCAAGTGGATCGTAGATCCTTTGTAGCAATGCAAATTAAATCCTTCCTTGATTAATGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078243

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078243 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G58520.1 +1 0.0 766 390/602 (65%) Protein kinase superfamily protein | chr5:23655312-23657943 FORWARD LENGTH=604

Transcript Sequence (2208 bp)

>PGSC0003DMT400078243 2208 pgsc_dm_v3.4
GAAACTTTTAGACCTCTAAGCTAGTGTTCAGTTGGAGCTAGGCTCAAATCATATACACAT
AACTAACCATTCATATTATTAAAAATCAACAAGGAAGACGTGATATTCTGGATCTGCGTG
CTTCAACTCATGGCAGCAGCATTGGAGTGCTGGTCCAGTAGAGCAAGTATGGACGAGGAC
ATGGTAGAACAAATTCTAATGAGTAACAATGACAGATCGGAGGAGCCACCGGCAAATGGT
TGCTCAGCCGGTGGTGCTAGTTCTACCGGCGCCGGAAGCAATGGAAGTTTTAAAGAGTCC
TCTGCGATGCAGAAGCGTTTACAGAGGCTGAGCCGGAATGTATCGGAGGCCATTGCGTCG
CTTAAGAACTCGCTCAACCTTGAATCGGTTCGTGACCCGCCCTCGGACCGGGTTGAGACC
TGCCGGAAGCACGTTTGGGGAAGTGTGGTACGGGGCTTGACTCAGCTTTATCCTGGTAGT
CAACTTCCGGAGAAGCTTGTCTCTAACATTCGCAAGCATTACGATTCTTTTCCACTCAGC
TATGGGCAAGCTGGATTCGAAATGAAGGATGTGTTTCTACATATTAGATTGATAGAGCAG
GCATCTGCAGAGGACCACCCAGCCATTATGATACAAGAGGTGTCTGATGATGAAGTCCAA
GGGTCGATTTTCAAGTTGACATTTGCATGTAACTCCTCTATTTCATGGCCTGCAATGTCC
GGGGCACTCGACAGCGCCTCAATTTGCTGCAAAAAGATACAGATCTTTGAAAAGAAAGGT
TTTACATTGGGCGTTGTGATGCTTTTGGTTCAATCTGGAAAAGAAAAAATGTTTAAAGCT
CGTATCGAGAATGTTCTTAAATCATCCCTTAAGAAGCCAAAATCTACTTCGATGAAGAAG
CTGCCATTTGGCCTTTGTGGGACTCAAGAAGAGAACACAAAGAACAGAGAATATGGAGAC
ATTGAAGAGGACTCTGGGCAGCCAACTTACAAAAATGGATTCGAGAATTCGAGCCCAAAG
GTCCAGCTTCAAATGCCTTTACCTACTTCTTTGTTTACAGCCTCGGTGGATGAGTGGCAG
ACTGTGTTATCTGGTGGGGAAGAGATTGGAAAGTGGTTATTGAGCTCTGATAATCTTGAG
TTCATCGATCAGATTGGACCTAGTACATTCAAAGGGGTATACAAGGGAAAAAAAGTTACG
ATTGAGAAGCTCAGGGGCTGTGACAAAGGAATTGCCTATGAGTTTGTGCTTCGAAAAGAT
TTGTTGGAGTTGATGACTTGCGGGCACAAGAGTATATTGCAATTTTTTGGTGTTTGCATC
AATGAAAATCATGGCTTGTGTGTTCTGACTAAGTTGATGGAAGGTGGATCAGTTTATGAC
TTATTGCTAAAGAAAAAGAAAGTCCAGACTAAAGAAATAATGAGGATTGCCACAGATGTA
GCTGAGGGAATCAAGTTCATGAATGATCATGGAGTTGCATATAGAGATCTCAATACACAG
AGGATCCATTTAGACAAAAATGGGAATGCTTGCTTGGGCGATATGGGCATATTAGCTGCC
TGCAGGAGTATTGACGAGGCCATGGAGTATGAGACTGATGGTTATAGATGGCTAGCTCCT
GAGATAATTGCAGGTGACCCTGAAAGTGTCAAAGAGACTTGGATGAGTAATGTATATAGT
TTCGGAATGATTATATGGGAATTGGTGGCTGGCGAGGTAGCATATTCTGCTTACTCGCCA
GTACAGGCTGCTGTTGGGATTGCTGCTTGTGGGCTTAGACCTGAAATTCCAAAGGATTGC
CCACAAGTTTTGAGATCTCTTATGATCAAGTGTTGGGACAATTGTCCTTCAAATCGTCCT
CAGTTCACGGAAATTGTGTCAACATTGGTACGTTCCAGCAGTAATAGCAACAGTAAGAGT
AGGTAATGAAAATCCTTTCCAGTAGGTAATGAAAATCCTTTCCATCTCATAAAAATGTAA
AAGAAGCTGTTTTAGTCTAGTAGATGCCGCAATCCCTCGTGTAGATCTTTTGTAGTAGCA
ACAACAACATACCCAGTGTTATCCCTCAAGTGGATCGTAGATCCTTTGTAGCAATGCAAA
TTAAATCCTTCCTTGATTAATGATAAATATCCTCCTATCATCATATATAATGAAAGGAAA
AGAAATTTACTGGATTTTCCCCTCTTGGAATGTCTTTCCAGCTTAATT