Microarray Probes on PGSC0003DMT400078225

Probe IDChipProbe Sequence
CUST_22745_PI426222305 JHI_St_60k_v1 TCGCACCTCTTCAATCCAGATTGTTGGCTATAAATTGTAAGCTACAAATAAATATGGTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078225

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078225 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G47070.1 +2 3e-07 48 34/66 (52%) LOCATED IN: thylakoid, chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Thylakoid soluble phosphoprotein TSP9 (InterPro:IPR021584); Has 37 Blast hits to 37 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr3:17337205-17337507 REVERSE LENGTH=100

Transcript Sequence (864 bp)

>PGSC0003DMT400078225 864 pgsc_dm_v3.4
GCAGAAGTAGAAGGGATAATAAACTTGTGGAGAACTCGCGCTACATCATACGGCTCATAT
TCATCCTACTAGAAATCAGATCAACTATATTATCCACATTGGAAAAATCGATTATTGCTT
CTACACAGAACCAGAAAATTGGAAAAAGCCCTAATTTTGAAATTCAATGGCGTCGTTGAA
CTTGTTCGTCACTCCGATAGCAGCCGTAACCACACAACAACATCGAAGAAGAGTATACAC
GGCGGCTACGGCGTCGAAGAGTTCCGGCGGAAGCACTGAGGAGAAATCGCTTTTGGATTT
TATACTTGGTGCATTACAGAAGCGAGACCAGCTATTGGAGACAGATCCACTGCTGAATAA
GGTTGAGGATAAGAGTGTAAGCACCACCACTACAGGCCGGAAGAACTCTGTTGCTGTTCC
TCCTAAGAAGGATGGCGGCGGATTTGGCGGATTTGGTGGCCTTTTTAATAAGAAAGAATG
ATTCTACTCTGTGAGTCTGCTTAATTTTTTTTCACAAAAATTCTGCTTCCTTGTATGAAA
TTTATAATTTACTTCACTCTGTAATCTATTACTACTATTGAATTGAACAATTCATGAGCT
ACTTGCTTGCTCTGCAACATTGGTTATTTGGTGATGGTAGCTGCATTTGTATACTATAAC
ATACTTTTAATACACATTTCCTCCCAATAAACATCATATCTGTTGTTCTGAACATGTGAG
TTCGCACCTCTTCAATCCAGATTGTTGGCTATAAATTGTAAGCTACAAATAAATATGGTG
TCTGATGATATTTGTGGCTGATTTTTGAGTTTATTCAAGTTATTGAAATTTGAGGAATCG
CTACTATTAATGTATATCTATTTT