Microarray Probes on PGSC0003DMT400078219

Probe IDChipProbe Sequence
CUST_22566_PI426222305 JHI_St_60k_v1 AGGTGACATTTTTTGGATATTGATGCAATGTATTGAGGTCTGATAGGATCGCACAAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078219

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078219 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G04110.1 +2 1e-25 111 70/196 (36%) DNA GYRASE B3 | chr5:1110757-1114112 REVERSE LENGTH=546

Transcript Sequence (2187 bp)

>PGSC0003DMT400078219 2187 pgsc_dm_v3.4
GAAAAAGTTCAGTTTTTTCTTTCGTTCAATTTTTCGGCCTGAAAAATTGAATCGCGCAGT
AGCTCAAGAACAGTAAAGAGTCTGAATCTGAGTAGATTTCAGAGAAAACTTGAAAAGATT
GAATTTGGGCAAGATTTCGAAGAACGCGATAAGGAATTAGGGTTTAAATCTTCATTTTTG
CGCCTTCGAGAAAATAAAAACGACGATTTTAATGAATCAGAGACGTAATTATCTGAAATT
CTTCTGGAAATTTGATAATTTTCGTAATGATCGGCGAATTACAACATCATAACTTGTTTT
CTGACAAGAAGATCAAGTAATATGTATCTTAATTTATTTCGTTGAATTTTTCATGCTTAG
AATTCGAAATTTTATATTGCCGCTGCTCCCCTGTTCTTCAATTCTAGCTTCAATGGAGGC
GACGGAAGAGCTGAGATCAGTGGCTTTTGATTGAGTTAAGAGAAGAATCAAGAGCCCTTT
ATAAAGATTCTAAAGTGTCTCTTCGTGACTGGAAAAGGGTTGCCGATAAATAAAGACTAT
TAATCCTTCTTCTACATTCATATATGTGAATCTGTGATGTATGTTTCTTCTACGTGTATG
TATTTAATATACATAGATATTCATATCTAATAATGTATATATGTATTGTTATACCATTAG
TTGTCTATATACATTGCGTGTGCATCAATCTCCTGAAAGTCTAAGTACATGTGTAGGAGA
TATGCATAAATGCATTCATATAGTCATGAGTCATGACTGTCGAATTTTGCTAACAGATAA
TCAGAAGATTTTCAAAGTAGTTGCATTAAGCTTACTGTGTTTTCTTGACATTTGAGGAGA
AGGGGTCTTAGATCTGGTTCCTGATGAGACTTGTGCTGATTAAACTATTGCTCTTTGTAT
CCAGTCTTACTCATTCGTCTGTTTAACTTCTCATTTTTGGCATATAGAGAAGGGCTGCAT
AAGTTGCTGCTGACGGAGCTTGTACTGCTGTCAAACGGGGAACTTGGATAACCCTTTCAC
TCGACCAAAAGCTTTCATTCACGCTTGATTCTGCTGCACTAGGTACTAGTATCCTATAAA
ATAGTGATCTCTTTTAAAGAAGTCTTGAGGAACTGTGATATATTCACTAGGAGACAAACT
CATTCACTCTTGTTCTTCCATGTTCTCGTGAAGTATGACGAAAGCAAAAGAGCTACCGGA
TCCAGCCCTGACCAGTGAGAAGAAATTGGTAATCCCAGTAGGACCCAGGTTTCAGGTTGA
TGTTGATGTTCCAGATTGGGCCAACTCTCCGAATAAGGGAACTCCAGTTGTAGCAGCAGA
TAATGCATTAAGAGCTTCTATTCCATCAATGGAGGAAATGGTATGCAAGTATAAAAAGGA
GGAATCTGATACTTCAAAATGGCTTGGTACACTGGTATGGCCAACAGACGACAACCTAGA
AAACAAGGAAGTTAACGAGGCATTGGTTGGGAAAGGGAGAAACGAACATTGTTCTTGTAG
GTCCCCTGGATCTTTCGAGTGTGTTAAAAGACACATTAAAGAAGAAAGCATGAAGTTGAA
GTCTGAACTGGAGACAGCCTTCAATGTCTGGAAGTTTGATGAAATGGGAGGAGAAGTTTC
CCAGTTGTGGAACACTAAGGACCAAAAAAAGTTCAGGTCCCTCGTTAAGACCGGTCTGTC
TAAAGGCAAAAGCTTCATGAAACCAGCATTAGCATCTTTTCCTTCCAAGAATAGGCAAAG
CATTGTCAACTATTACTTCAATGTTCACATTCCTCAGCGTATCAGGTCAAATGGTATAAC
AATTAACACCGATGATGAAGATGAAGAAGAGGAAGAAGATGAGGAAGAGGAGGTCACTGC
TCCCAGACATTCTCGTAAAAGGAATCGAGCAAACAAAGGTGTCTCTACTAGTTCTAAATC
TCTGAAGACAAAGTACCTAAGTGGTCGACGATGACACCAGAAGTATCAATATACATTCTT
TTTTAGTTGTCATAGAAATGGAATATACAGAGAGAAATGTATTTTATCACTCAATCCAGG
GAGAGTTTTGGGATGGGGTTCACATTTTATACATAGGTTTTAAAGTCAAGAAAAGGTGAC
ATTTTTTGGATATTGATGCAATGTATTGAGGTCTGATAGGATCGCACAAAAAAACTATAC
ATAAATACATTGATATCTGGATTTGAG