Microarray Probes on PGSC0003DMT400078163

Probe IDChipProbe Sequence
CUST_22567_PI426222305 JHI_St_60k_v1 CAGGTTTTGTCTTGTGAATTTCATACTGATGTTTTTAAATAGCGATACTGAGTCTTGCTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078163

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078163 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G02500.1 +2 0.0 1141 599/652 (92%) heat shock cognate protein 70-1 | chr5:554055-556334 REVERSE LENGTH=651

Transcript Sequence (2198 bp)

>PGSC0003DMT400078163 2198 pgsc_dm_v3.4
CTACTTTCTTCTTTCTTCACAAACCTCATTTTCTCTTTTAGCTCTCTATTTTTTTCTTCT
CTGATAACCGTCGCCGTTTAAAGCAATGGCCGGAAAAGGTGAAGGACCGGCGATCGGAAT
TGATTTGGGGACTACGTATTCTTGTGTCGGCGTTTGGCAACATGATCGTGTGGAGATTAT
CGCTAATGATCAAGGAAACAGAACTACACCATCTTATGTTGGATTCACTGACACTGAACG
TCTCATTGGTGACGCTGCTAAGAATCAGGTCGCCATGAATCCGATTAACACCGTTTTCGA
TGCAAAGCGGCTTATTGGTAGGAGGTTTAGTGATGCTTCTGTACAGGAAGACATGAAATT
GTGGCCTTTCAAGGTTATTCCTGGGCCTGGTGATAAGCCAATGATTGTAGTTACCTATAA
GGGTGAAGAGAAGGAATTTGCTGCTGAAGAAATCTCTTCTATGGTGCTGACAAAGATGAA
GGAAATCGCAGAGGCCTTCCTTGGATCTACTGTGAAAAATGCTGTGGTGACTGTGCCAGC
CTACTTCAATGACTCACAACGCCAGGCTACAAAGGATGCAGGAGTTATTTCTGGACTAAA
TGTCATGCGTATTATTAATGAACCTACAGCTGCTGCCATTGCCTATGGGTTGGACAAAAA
GGCTACTAGTGTAGGTGAGAAGAACGTGCTTATATTCGATCTTGGTGGTGGTACGTTTGA
TGTATCCCTCCTCACTATTGAAGAGGGTATCTTTGAGGTGAAGGCCACAGCAGGAGACAC
TCACCTTGGAGGTGAGGATTTTGATAACAGAATGGTGAACCATTTTGTCCAGGAATTCAA
GAGAAAGCACAAGAAGGATATCAGTGGTAACCCGAGAGCTCTAAGAAGATTAAGGACAGC
TTGTGAGAGGGCTAAGAGAACTCTCTCTTCCACTGCTCAGACAACAATTGAAATTGATTC
CCTGTATGAGGGAGTTGACTTCTATTCTACCATTACCCGTGCCAGATTCGAGGAGTTGAA
CATGGATCTCTTCAGGAAGTGTATGGAACCAGTTGAGAAATGTTTAAGGGATGCCAAGAT
GGACAAGAGCACCGTTCATGATGTTGTTCTTGTAGGTGGATCCACTAGAATTCCCAAGGT
GCAGCAGTTGTTGCAAGACTTCTTCAACGGCAAGGAGCTCTGCAAGAGCATCAACCCAGA
TGAGGCTGTTGCCTATGGTGCTGCTGTGCAAGCTGCTATTCTCAGTGGAGAAGGTAATGA
AAAGGTCCAAGACTTGCTGCTTTTGGATGTCACGCCACTTTCTCTTGGGTTAGAAACTGC
AGGTGGTGTGATGACTGTCTTGATTCCAAGGAACACCACAATTCCTACCAAGAAAGAGCA
GGTATTTTCCACCTACTCTGATAACCAACCCGGAGTATTGATTCAGGTGTTTGAAGGTGA
GAGAGCAAGAACCAGAGACAACAATCTATTGGGTAAATTTGAGCTCTCTGGTATTCCCCC
TGCTCCTAGGGGTGTGCCTCAGATCACAGTCTGTTTCGACATTGATGCAAATGGTATCTT
GAATGTCTCTGCTGAGGACAAGACTACTGGACAGAAGAACAAGATCACAATTACCAATGA
CAAGGGTAGGTTGTCAAAGGAAGAAATTGAGAAGATGGTCCAGGAAGCTGAGAAGTACAA
GGCAGAAGATGAAGAACTCAAGAAGAAGGTGGAGGCCAAAAATTCATTGGAGAACTACGC
TTATAACATGAGAAACACAGTGAAGGATGAGAAAATTGGTTCTAAGCTTAGCTCGGATGA
CAAGAAAAAGATTGAGGATGCCGTCGATCAGGCAATTTCATGGCTTGAGAGCAACCAGCT
TGCAGAAGTTGATGAGTTTGAGGACAAGATGAAGGAGCTCGAGGGCATCTGTAATCCCAT
CATTGCAAAGATGTACCAGGGTGCTGGTGGTGATGCAGGTGTTCCTATGGATGATGATGC
TCCACCATCTGGTGGCAGCAGTGCAGGACCTAAGATTGAGGAGGTTGATTAAGCGGTTGA
TAAAAGATACTAGTAGTTGGTTTCATTTTCATTAGTATAGTTTAGTAGATTACTTTGAAC
TGGCTCTTATTTCAGGTTTTGTCTTGTGAATTTCATACTGATGTTTTTAAATAGCGATAC
TGAGTCTTGCTGTTTACTACACTCTTTTTGGATTATTC