Microarray Probes on PGSC0003DMT400078157

Probe IDChipProbe Sequence
CUST_22732_PI426222305 JHI_St_60k_v1 TGGATATCTGTAGTGATGCTCTCATGCTCTAGAACTTGTAATTTCTCATTACAGTATCAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078157

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078157 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G59970.1 +2 2e-35 84 40/41 (98%) Histone superfamily protein | chr5:24146352-24146663 REVERSE LENGTH=103

Transcript Sequence (538 bp)

>PGSC0003DMT400078157 538 pgsc_dm_v3.4
CACCATCCACTTCATGTTTCATCAGCAAAATTACATCAAAATTCGTAACCCTAGAAACTT
TCTCTGTGAAAATGTCTGGTCGTGGAAAGGGAGGCAAGGGATTGGGAAAGGGAGGAGCCA
AGAGGCACAGGAAGGTTCTAAGAGACAACATCCAAGGTATCACTAAGCCAGCTATTCGCA
GGCTTGCTCGTAGGGGTGGTGTGAAGCGTATCTCTGGTCTGATCTATGAGGAGACCCGTG
GAGTGTTGAAGATCTTTTGGAGAATGTGATTCGTGATTCTGTCACCTACACTGAGCACGC
CAGGAGGAAGACTGTCACTGCTATGGATGTTGTCTATGCTTTGAAGAGACAGGGAAGGAC
TCTCTATGGATTTGGAGGTTAGATTGGGGGTTGTATGTTGGTAGTAAATGTAGGTTTTAG
TTTACAATTGCGTTTATGCCTGTGTTGGATATCTGTAGTGATGCTCTCATGCTCTAGAAC
TTGTAATTTCTCATTACAGTATCAATGAATAGATTTCAGTTTCTAGTGATTACATTGG