Microarray Probes on PGSC0003DMT400078081

Probe IDChipProbe Sequence
CUST_22553_PI426222305 JHI_St_60k_v1 ATCAAAGTGTATCAATTTGAAGGCTTCATCTTCTTCTTATTCTGCATTCTCCGATCCCTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078081

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078081 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G07110.1 +3 0.0 1101 573/752 (76%) fructose-2,6-bisphosphatase | chr1:2178363-2183980 REVERSE LENGTH=744

Transcript Sequence (2538 bp)

>PGSC0003DMT400078081 2538 pgsc_dm_v3.4
GTCCTATCCACAACTGACGACTACTTTAATTACATAATTTTTATTATTATTATATTCAGT
TAGCATAAGCCTACAGGAATACTTTTTTCTTTTTTTTGTTTGGAGAGAAATTGTAGCTTC
AAGCAAAAATGGGTACTGGTTCATCGAAGAACACAGACAGTAGCTCGCATGGCAGCGAAG
ATAGAGAAGATCATGGAGGAGGACAGCTTTACGTTTCTCTCAAAATGGAGAATTATAAGC
TTAAAGGAGAACTCATTCCTCATGTTTATGGTTCCGTTCCATTAATTGGCTCATGGGATT
CATCTAAAGCTCTTCCGATGGAACGGGAATCAACTTCTATGTGGGAACTGAGTTTCGTTG
TTCCTCCTAATCACGAGACATTGGACTTTAAGTTCCTTTTGAAGCCAAAGTACAATCATG
AGCCTTGTATAGTGGAGGAAGGCCCAAACCGTGTACTTATTGCTGGAACGTTGCAAGGGG
ATGGGCGTTCAGCCTCGTTTAAGCTGGAAAATGAAGAGATTATTGAATATAGAGTGTTTG
TTAAAGCAGACAGAGTTTCACCATTTGACCTTGCGGCTAGTTGGAGAGCCTTTCAGGAAA
ATCGCAGGCTTTCTACTGTTCGAGGAGTACCAGATGTTAGCATAAATTCGACACCAGCAA
TGGGTGCAGAGCATGGCTCTTCGGCTAGTCTAGAGCTTGATCTTGAACATTATGTTGTCC
CTGCTCCAGCAACATCTGCACCGGTTTATGCTGCTAACTTGACAGAAACTCCTAGGTCTC
TAACACGTAAAGGGGTATTTTCTGGGACAGATGGCACTATCATTCCAAGGCCTTCCTCAA
AAGATGGTCACACTTCAAATGATCGGTCTGCTACAATAAAGCAGATGGAAGTAATTGTCC
CGGATCCAACTAGAGTCCCCTCAGGGTCTGGTACGGTTGAATCCAAGTCCATGGGTGCGT
TCTCGTCTTTGCAAAAGCAAGATAGTTACAGGGGAATCCTTGTAGATAGGGGTGTGGGAT
CTCCAAGACTAGTAAAATCACCCAGTACAACCAGTTTTACTCTTGATCTCAAGCCTGATT
CAGATGCCAAGAATGTGATGCCAGCTGCTGCAGGAGCAGTTGCAGCTGGAGCTGTAGCTG
ATCAGATGCTTGGGCCAAAGGAAGACATGCATCTAGCAATCGTTCTGGTTGGCTTGCCAG
CTCGTGGCAAAACTTTTACTGCCGCTAAGCTTACTAGGTATCTTCGATGGTTAGGTCATG
ACACCAAGCACTTCAATGTTGGGAAGTACCGCCGACTCAAGCACGGAAGTAATCAGACTG
CTGATTTCTTCCGAGGTGACAATCCAGAAGGCTTGGAGGCTCGCAATGAGGTAGCTGCCC
TTGCAATGGAAGACATGATCGCTTGGATGCAAGAGGGTGGTCAGGTAGGAATTTTCGATG
CCACAAATAGCTCAAGGAAAAGAAGGAATATGCTTATGCAGATGGCTGAGGGAAAATGCA
AGATAATTTTCTTGGAAACCCTCTGTAATGATCCTAAACTAATTGAAAGAAACATACGCC
TCAAAGTTCAACAAAGTCCAGACTATGCTGAAGAGCCAGATTTTGAAGCTGGATACAGGG
ACTTCAAGAATCGCCTTGATAATTATGAAAAAGTTTATGAGCCAGTAGAGGAAGGTTCTT
ATATTAAAATGATTGATATGGTCAGTGGTCATGGAGGACAAATACAAGTAAATAATATTA
GTGGCTATCTTCCTGGGAGGATTGTCTTCTTCTTGGTCAATACACATCTCACACCCCGTC
CAATTTTGCTAACAAGGCATGGAGAGAGTTTGTACAATGTTAGAGGCAGAATTGGTGGTG
ACACTGCGATAAGTGAAACTGGGGAGCTCTATGCAAAGAAGCTTGCCAATTTTGTTGAAA
AACGACTGAAAAATGAAAAGGCCGCTTCTATATGGACCAGCACATTGCAAAGAACAATTT
TGACAGCTAGTCCAATTGCTGGGTTTCCCAAGATACAATGGCGAGCCCTTGATGAAATAA
ATGCTGGTGTATGTGATGGGATGACTTATGAAGAAATAAAGAAAAATATGCCCGAAGAAT
ATGAGTCACGCAAAAAGGACAAGCTGAGGTATAGATACCCTAGAGGCGAATCTTATCTTG
ATGTCATACAAAGGTTGGAGCCGGTGATTATCGAGCTTGAAAGACAAAGAGCACCAGTGG
TGGTGGTATCTCACCAGGCCGTATTGAGGGCTTTGTATGCTTATTTTGCTGATAGGCCTT
TGAGTGAAATTCCACACATAGAGATGCCACTTCACACAATCATAGAGATACAAATGGGGG
TTACAGGAGTACAGGAGAAGAGATACAAACTGATGTAGGTCATTGCAACTTGACTTTCTA
ATACGTATATGCAGCAATTCTCTCATTCAAATTGTAGCAACTGATACCCAAAAAATTGTA
TATCGACGAGTGTTTGACATCAAAGTGTATCAATTTGAAGGCTTCATCTTCTTCTTATTC
TGCATTCTCCGATCCCTT