Microarray Probes on PGSC0003DMT400078033

Probe IDChipProbe Sequence
CUST_22771_PI426222305 JHI_St_60k_v1 GAGACTATCAACTAAGAGAGTTGTGGATGTATACGGTAATACAACATTGAATGTCTTTCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078033

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078033 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G07270.1 +2 3e-175 514 281/460 (61%) Cell division control, Cdc6 | chr1:2229757-2232897 REVERSE LENGTH=505

Transcript Sequence (2092 bp)

>PGSC0003DMT400078033 2092 pgsc_dm_v3.4
TATATATCCTATATAAATAGCAAATAATTATTTTTAATCTACAGAGACGTTCACTTCAGT
CGAACACTGCAAGCACTGTTCATCTCATCGGAAGTTCAAAATGCCGACAATCGTCGACCG
TCGTTCAACACGTGTCTCCGGTGGGAGTAAAGTCGCCGATCCAATCGCCATCAACGGTGA
GATTGACTCCACTCCTCAAAAACGCAAACTCAGATCCAGTTCCAGTTCCACTACTGAAGA
CAGTAGAGTAACTTCGGATTTAACTCCGTCGCCCTTGAAAAGCTCTCCGAGCAAATGGAA
ATCGCCGCGCCGATGTGTCAATGACAGCCCTAAGAGTACTCCAAATGCAAATCGAGGAGC
TAAAGCAGTAAATCTGAGCAAATCACCTGTGAAAAGGAGATTATCGGAAAGTTTTCTAGA
GAAGCCTATGTGGAATCCAAGAGATATGGAGCAGTTAAATGGAGTGAAAGAGGCATTGCA
TGTGTCTAGGGCTCCATCAAATCTGGTGTGTCGAGAAGTTGAGAACAATAGAATTCTGGA
GTTCTGTAAGCAAGCAGTGGAACAAGAGAAGGCTGGAAGTTTGTATATCTGCGGCTGCCC
AGGGACTGGAAAGTCTCTATCAATGGAGAAGGTTAACAAGGTCCTGGTTAATTGGGCAGA
AGAGTCTGGTTTTCAGGCTCCAGACACATTATCACTCAACTGCAGTTCTCTGTCAAACAC
ATCTGACATTTTTGGCAAGATACTTGACAAAATTAAACTACGGAGAAAGATAAATAGTTG
CAAATCACCATTGCAGTATCTTCAGAAAATGTTTTCTGAGAAGCAGCAGTCAGCAGTCAC
AAAGATGTTGTTAATAGTTGCTGATGAGTTGGATTACTTGATCACAAAAGACAGAGCTGT
GCTTCATGAGCTGTTCATGCTAACAACGCTCCCGTTCTCCAGATTTATTCTGATAGGAAT
TGCTAATGCAATAGACCTAGCAGATAAATTTCTTCCAAAACTACAATCCTTGAATTGCAA
GCCAGCAGTGGTAACATTTCGTGCCTATTCTAAGGACCAGATCATCTCCATTCTTCAGCA
AAGATTAAAGGCATTTCCTTACACAGTCTTCCAGCCTCAAGCATTGGAACTATGTGCACG
GAAAGTTGCTTCTGCATCTGGAGATATGAGGAAGGCTCTATGGATATGCAGGAGTGCAAT
TGAGATGTTAGAATCTGACATAAGAGATTCTATCAACAGCCTTGATTTACCATCATTACA
TGGAGGAGTTTCTGATCAACAGAGGGATTGTGCTTGTGATAAAGCACTTATACACGAGAG
CAATGTTGTTAGGGTTGATCATGTGGCTATTGCTTTATCAAAGGCATATAGATCGCCAGT
GGTGGATACTATACAATCACTTCCACAACATCAACAGATTATTCTTTGCTCTGCTGTCAA
GCTATTCAGGGGGAAGAAGAAGGATGCCACTATAGGCGAGCTGAACATCTCTTACCTTGA
TATCTGTAAATCAACTTTAATACCACCAGCAGGAATCATGGAGCTATCAAGCATGTGTAG
AGTGCTAGGAGACCAGGGGATCCTAAAACTGGGGAAGGCTAGGGAAGAAAAATTAAGTAG
AGTAACTCTAAAGGTAGATGAAGCAGACATCACCTTTGCATTGCAGGGAATACGCTTCTT
TCGAAATTGTCTTCAACAATCTTGATGATTGACTTGAACAATATTGTGTTTCTTTATTAT
TTATTCCGTTGCTCAAATAAATTGCCAGTTTATGGTCCAAACATGAAGAAATCAAACTTG
GTCAAAGTGGCTATATATGACTTACGGATGAATGGAACAGGAACATATGGGGTTCTCCAT
TAAATGTTGGAATTTCCATGTGGCTCCCTCCCTTATCATACTTTTAGTTCTCAAAGAGAA
AAATACAGTACATTATAGGAAGAGACTATCAACTAAGAGAGTTGTGGATGTATACGGTAA
TACAACATTGAATGTCTTTCAATTTCAAGAATTTCTGGAAACAAATTTTGACCTGTAAAC
TTTATCGTATTATTATCAGATGCTGATTCTCATCTTCAAGAATCAAATGGAA