Microarray Probes on PGSC0003DMT400078024

Probe IDChipProbe Sequence
CUST_22646_PI426222305 JHI_St_60k_v1 TATATGTTCATGTGGGCGTTCTCCTCGCTGCTAATGGCAGAGAGTATGTTCTTGGAAGAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400078024

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400078024 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G07350.1 +3 3e-16 81 38/52 (73%) RNA-binding (RRM/RBD/RNP motifs) family protein | chr1:2257732-2260101 REVERSE LENGTH=382

Transcript Sequence (1941 bp)

>PGSC0003DMT400078024 1941 pgsc_dm_v3.4
GGGGATATCAACATCATTAAATGCTTTTTTTCTCTGGTTAGGTTGAAGATGTTCGTCTTG
TTTTTGACCCATGGACCCGCGAATCTCGTGGGTTTGGTTTCGTGACGATGTCCAGCGTTG
AGGAGGCTGATCGCTGCATCAAGTCTCTGAATCGCTCAGTACTTGAAGGCAGAGTTATCA
CTGTGGAGAAGGTAGAATTTATAGAATATTTGCTCAGTTTTTTTGAATCTTATGTTTGCA
ATTTTCTCTGGTTATCAGCTCTTAGTTATATCAATATCTTATATTGCTTCAGTAATTTGA
TCAGTTTGAAAATTGTTAGCTTGTTTCGCAAGGAAGCTGTGTGTAGCAGCTCTTCACCAA
AGTCCAAATAACAAATCAAAACACATCAAGCCAACAGACTGTTAACCAGAGGGTTGTAGC
CTTCATTTTTCCTTTATTCAGCTGCGCCCTTGTTGCATGTTATTCATTTCTCATTGGTTA
CTTATTTCGTGACGTCGTTGTATTGCATCAACCCGCCAAAGTCTAGATTTGCTGTTTGAC
AATTGTCTCCTATGCAGGCTAGGAGGAGAAGAGGTAGAACACCTACTCCAGGAAAATATT
TGGGGCTTAGAACTGTTCGCGGTATGATATTGTATCCTTTCCTAAGCAATACTTGACCTG
GGTTATTTGTCTGTGATGTCTTCTAATTTCCACCTTGTAAATGTAGTTCGTCGTGAATCA
CGAAACTATCCTCATCATTCAAGGAGTCGCTCTCCTTGTTACTCATCTGAAAGCTACAGG
AGCAGGAGCAGGTCTTACTCTCCATATTACCGACAAGAGCATAGATCATACTCTTATTAC
AGAGGACGCCAGAGATCTCACTCATCATATTACAATCGACACCACTGCTACTCAGAATCA
CCTTATTCTCCTTACTATAGTCGTGTCAGGTCTTACTCTCGATCTTTATCCCCATATAGT
CGGCGTGATCGGTCCTACTCTCCAGATGACCGTTACTACAGAAGAAGCCGTTACCATGAC
TATTCTCCCGACAATCATCGGCGTGATCGTTCCTATTCTCCAGATGACCGTTACTATAGA
AGAAGCCGCTACCGTGACTACTCTCCCGAAAGCCGTGATCTTTCGGACTCTCCAGATGTT
CGTGACAACAGAATGAGCCGCTATCGCGATTACTCTCCGAACAGTTACTATTATCGAAGG
AACCGATATCGTTCCATTTCTCGGAGCATTTCACCTCGATATCGGAGAAGCTACTCATGC
AGTGCATCACCTAGGTGGTCAAAGAGGAGCTATTCAAGAAGCGTTTCCAGGAGCAGCTGC
TCTCGTAGCAGTTACTCTCCTAATCCGAAGAAAAGCTCTAAGAAGAGTCGCAGTGTTAGT
GCATCTTCCAGATTTGTTTCAAGGTCTGTTACACCTAGGTCTTCGCCTTCATCATGAAAG
GACTACACTACTAGGAAGGTCTAGTCTGTCACTCTCTGTTGCAAAGAGTTTAAAGTTGTA
CTAGATTGGTCACTCAAGTAGAATTACTCAAGATAACAAATCTGCTTTCCAGCTTATGTG
ACTGGTGGAAATGAGATCTAGCTGTACTATTGTGTTTGTAATTTAATGCAGAGGTAATAC
GGTGTATTGACCGAATATGGAAACGACACTAGCATATTAATGTGTACGAAGCCAGTACAG
AAATCTCTCAATTTCTTCATTGCTTTCTAGTGGCTTTTATATGTTGGGTGTGTATAACAT
AGTATTTCATGGGTTATAACTTGTGAGTATTCCTGTAACTATATGCGGTGCATGACTATT
GAAGTCTTGAACTAGTAGTAATTCACACAGGTTTAAATGCTATAGCCTTGATGTAGTAGT
TACATAGCTGTTGGCCATGATTATATGTTCATGTGGGCGTTCTCCTCGCTGCTAATGGCA
GAGAGTATGTTCTTGGAAGAA