Microarray Probes on PGSC0003DMT400077990

Probe IDChipProbe Sequence
CUST_22578_PI426222305 JHI_St_60k_v1 CCTTGTAATCCCATTATACAGATCTATGTTTTGCTTTGATAACTGAATTGGACGTGATGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400077990

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400077990 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G07430.1 +1 7e-70 213 108/157 (69%) highly ABA-induced PP2C gene 2 | chr1:2281151-2282656 REVERSE LENGTH=442

Transcript Sequence (2120 bp)

>PGSC0003DMT400077990 2120 pgsc_dm_v3.4
CTCATTGTATCTGCCATTGATTTCTCTTCTCTCTTCTCTCTCTGTTTACTGCATTTAATT
TTTCCGGCAATGGTTCTGTAAACTGCATATTTTTTCTGAGTGGGGACTAAAAATTAAAGG
CCTCTTCAGTTTCTGAAGTTGTCTTTGCTTGTTTTAAAAGTGTGAATGGCAGAGGTCTGT
TTTGGAGTTGTAGCTGAAACTGATTCATCGTCACCGTGTGAATCAAGTTCACGGGCGGTG
AGGAGGAGGAGAATGGAGCTTCGAAAGATAAAAGTCATCGCTGGAGTTACTCAACCCGGA
ACAGAGAATGGAATTAAACGTCCAAAATTGAAACTTATTTCCGGTTCTGTTTCAAGGATT
TGTGATAACGCTGTGGAAAGTTCTAGCACCGACGATGATGAAGAACAACTGAGATTAGTA
GAGACGAAAGGGTCACCGCCAACTATTATTTTGACACCATTTTTGGGTCCTTCGAATTCT
ACTCTCCTTGTTCAAGCAGTGGCTTACCCAAAGTTTGGCTTCGCCTCTGTTTGTGGAAGG
AGGAGAGATATGGAAGATGCAGTCGCAATTCATCCTTCATTTTGCCAAATGGAACAAGGA
AACAGTGGAGAATTGCATTACTTTGCCGTTTACGATGGTCATGGCTGCTCTCATGTGGCG
ACCAAGTGTAAAGAGAGGTTACACGAGCTGGTGAAGGAGGAGCTGGAGAACAAAGAAGGA
GATCATGAAGAGTGGGAGCATTCAATGAACCGAAGCTTCAATCGAATGGACAAAGAAGTG
ATTGAATGGAACAATAGCGTAACCGGCGCCACATGCCGGTGCGAACTTCATACACCGGAA
TGTGACGCCGTCGGTTCAACGGCGGTAGTCGCAGTTGTTACGCCGGACAAGATTATTGTC
GCGAATTGTGGTGATTCCAGAGCTATTCTTTGCCGAAATGGCAAAGCTATTCCTCTTTCT
AACGATCAAAAAGTAAATCCCTCGTCCAATACAAACAAAGAACTTGTTGGTGATAAATCA
AAATCGCTTGATCTATTTCGCTAATCGGATTAATTTTTGTGTATATGTTACATTTCAGCC
GGATCGTCCGGATGAACTTAACCGCATCCAGGAAGCTGGTGGCAGAGTAATCTACTGGGA
CGGCCCTCGTGTTTCAGGCGTTTTGGCTATGTCAAGAGCCATTGGTAAGTAGAATTAACT
TGTCCTTCTTCGTAGACAGAATCAGGAATTTGAGAAGAAAAATGCAGAATGTCACACCTA
AAATTCAAATCTCGGAAAATCAGAGTAGCTCAATTGGTTGACTATCTTTTACAGGATTGA
TGAGTGTTCGATTTCCACCTTGTAATCCCATTATACAGATCTATGTTTTGCTTTGATAAC
TGAATTGGACGTGATGATACTTACAAATTTGTGTAAAATATGCAGGTGATAATTATTTGA
AGCCGTATGTGATCTGCGAGCCAGAAGTGACGGTAACTGATCGCACGGCGGAGGATGACT
GTTTGATTTTAGCAAGTGACGGATTATGGGACGTAGTCTCAAACGACACTGCATGTGGCG
TTGCCGGTATGTGCCTGAAAAGGAATGCATCGCCGGCGTCTACGTCGGGAAATGGAGCCG
ACGGCGAGATGAATTCCGACCAATGTTGCTCTGATGCATCGATGCTTTTGACTAAACTAG
CCCTTGCTAGGCGGAGCTACGACAACGTCAGCGTTGTCGTGATTGATCTGAAGCACTACA
CGTAGAGAGCATTGAAGCTTTTTTTTCTTTCTTGCAGCCTTTTTTGGCTTTATGCTTTAA
CATTTCAGTGTGTTTATTTTGGGTGGCGTTCAGTTTTAGATTAGTTCTTTAGACGGTTGA
AATTGGAAGAAAATGACTTGGGGGAAAAAAGGGATTCAACAAATGAGAGTTTTAGGTTTT
GTTATCCTTGTTCTGCACTGCTTTAAATTATCCAAGGGATTTAGTATGTACAAATTAAGA
CTATAATATCAAGTTTACAAATGCCCCCAAAAAAATAAATCCGCAAAGAATCAAAGTTTT
TCATTAGTATCTTCTAGTATGGTAGGTCTTTCTGTTAATTCTGATGAATTTGATACTCCC
TCCCCTGAGTTAAATGATAG