Microarray Probes on PGSC0003DMT400077946

Probe IDChipProbe Sequence
CUST_22666_PI426222305 JHI_St_60k_v1 ATGGGAAGCCATGTCAAATCCTAAATAGTCGCACCACGTTACTTAATTTAGTTTTGTGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400077946

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400077946 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G07645.1 +1 6e-69 210 101/137 (74%) dessication-induced 1VOC superfamily protein | chr1:2367612-2368349 REVERSE LENGTH=137

Transcript Sequence (589 bp)

>PGSC0003DMT400077946 589 pgsc_dm_v3.4
AAAAAAAGGCCGAAAAGAAAGAGTGATAGAGGAGAAGAAAAATAAAAGAAGGAAAAAATG
GCATCAAATTTGGGACCAGCATTTGCTTATACAGTGGTGTATTGTAAAGATGTTGCTAAA
TCTGTTGCCTTTTATGCTAAAGCTTTCGGCTACAACGTTCGCCGCTTAGACGAAAATCGC
AAATGGGGAGAATTGGAAAGCGGTGCTACCACAATTGCATTCACACCTATGCATCAGCAC
GAGACGGATGACATAACGGGTCACGTCCAGACCCCTCAATCCCGGGGCGATAGACAAGCC
ATTGAACTTTGTTTCGATTATGTGGACATTGATGCTGCCTACAAGAGGGCAATTGAAAAT
GGGGCAGTGGCGGTGAGCGAGCCGGAGGAGAAGAAATGGGGACAGAAAGTTGGATATGTG
AGAGATCCCGACGGCAACGTAGTTAGAATGGGAAGCCATGTCAAATCCTAAATAGTCGCA
CCACGTTACTTAATTTAGTTTTGTGTAATAAATAATTGTATCCTCGTTGTGTAGTAGTAA
TTCAGGAATAATTAATAAATGTTGGGACTTGTAAGCTTTTATATTGATA