Microarray Probes on PGSC0003DMT400077708

Probe IDChipProbe Sequence
CUST_22084_PI426222305 JHI_St_60k_v1 ATACCTTGTCTTTATGTTTTCATGTGGTCATGTTTGAGGAAATAATCTCTTGTGGTCACT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400077708

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400077708 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G00880.1 +2 1e-26 102 49/86 (57%) SAUR-like auxin-responsive protein family | chr4:366692-367060 REVERSE LENGTH=122

Transcript Sequence (774 bp)

>PGSC0003DMT400077708 774 pgsc_dm_v3.4
CTTTACCATTCAACAACACCCTCAAATTTTCAGATTTCATCCTTTTGAAACCACTATACA
CACAAATAGATCATTAACAATGTTCTAACATAAATACAAAAATATTGTTTGTTTCATTAG
CTCTATCACTCTTTTTTTTGTAACAATGGGTAGTGGAGATCACAAACACCACCATCACCA
TTTGAATTTGCATGTTCAAGTGCATCTACCTCACATCCATTTTCACCATCACCATCACCA
TCAACACGGTCATGGGATAAAAGAAATGATAGGCATCCCAAAGGGTTGTCTTCCAGTATT
GGTAGGTCATGATGGTGAGGAACAACACAAGTTCATAATCCCAGTGATATACATTAACCA
TCCACTTTTCACACAATTGTTGAAAGGTAATGAAGAAGAGTGTGAACTTCATCATGATGG
TCCTATGAATATCCCTTGTCATATCGAAGAATTTCGATACGTTGAAGGTATGATTGACAA
AGAAACTCATGCCACCGGACACCATAACCACCATGCTTGGTGCTACAAGGCCTGAGGTTT
ACGAGTTAAACTTCTATATAATAAAAACGGAATATTCACTTCTACTATAGTTATGGATAT
GAGATAAATCCGATGTTTATTTGTTATCTAGCTATAGCTACTAGGGTTTTTTTTTTGGGT
GATTTATTGTGATCGTTCATTATTGTATACCTTGTCTTTATGTTTTCATGTGGTCATGTT
TGAGGAAATAATCTCTTGTGGTCACTTAAAATTTGAAGAAAAAAAAATTGTTCC