Microarray Probes on PGSC0003DMT400077507

Probe IDChipProbe Sequence
CUST_49554_PI426222305 JHI_St_60k_v1 ACTCTTCAGTGACTAGAGACTGCACTGGTTCTTCAAATAACACAGCAGCATCTTCGCCTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400077507

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400077507 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G10530.1 +1 2e-40 153 79/131 (60%) Concanavalin A-like lectin protein kinase family protein | chr5:3324978-3326933 REVERSE LENGTH=651

Transcript Sequence (1350 bp)

>PGSC0003DMT400077507 1350 pgsc_dm_v3.4
ATGAATGTAACATATGAAGCAGATGCTTCTCCAGCAAACGGTGTAATTCAGCTCACCAAA
AACCAGCTTGATAGTGGTGAAAGCTTTAGCGTAGGCCGAGCTACATATTCTAAAGAACTC
TATCTTTTGGACAAGGCCTCTGGGAAAGTCAGAGATTTCTCTACGCACTTCTCCTTTGAG
ATCAATTCACAGGGCAGAAATTATTATGCTGATGGTCTTGCCTTCTTCCTCGCTCCTGCA
GGTTCAGTAATTCCTGAAAAATACTCAGCCGCAGGAGAGGGCCTTGGCCTTGCAATTGAT
AATGGACTAAATACATCGAAAAATCAGCCTTTTGTTGCTGTCGAGTTTGACACCTTTAAG
AACGCTTATGATCCACCGGGTGATCATATAGGCGTTGATATCAACTCCATGGTAACTCTT
GTTAATGTGGCCTGGCTTAGTAGAATTCCCTATGGTACGAAAACTGATGCCTGGATTACT
TATAATTCAACCTCAAGAAATCTTAGTGTTGTCTTCACCGGTTTCAGACAACAAGGGAAT
ACCACAGTCACTGTCCTGCAGAACCTATCTTACAATCTTGATCTGAGGGAATATTTGCCA
GAATGGGTAACTTTGGTTTCTCAGATCCAGATGTACCCCAACCAAGCCCTGTGCCAGAAG
ATACTTCAAGCAAAAGAAGTCAGGACTAGTGATTGGATTGATTTCTGGTGGTTGTGTTTC
GGTAGCAGTATCTGTTTTTATATTGTTTGCATTTTGGAGAAAGAGGAAGCTAGGCTAGTT
GACCATGATAAGGGATCCCAAACAACAGTTTTGGCAGGCACGATGGGTTACATGGCTCCT
GAATGTCTCACCACTGGCAAAGCTAGCAAGGAAACAGACGTCTATAGCTTTGGTGTTGTC
GCGTTAGAAATAGTTTGTGGAAGGAAACCTATTGATCCTAAATCTGAGGAGCATCAAGTA
AATATTATTGAATGGGCTTGGAGACTTTACGGGATGGGAAATCTTAGTGAAGCAGTTGAT
CCTAGACTCTCATCAGAGTTGAGTGAACAGGAGGTGGAGCACTTGCTAATTGTTGGCTTA
TGGTGTGCTCATCCAGATAACAATTGCAGACCTTCTATTAGGCAAGCAATTCAGGTGCTT
AATTTTGAAGCTCCATTGCCCACACTCCCTCCAAACATGCCTGTGCCGATATATTGCAGT
TATGAATCAATTACTTCACTTGCATCACCATACGACTCCAATGGTCCTCAGATTTCTGAA
ATAAACTCTTCAGTGACTAGAGACTGCACTGGTTCTTCAAATAACACAGCAGCATCTTCG
CCTTCGGCATCACTTCTGAACACACGTTGA