Microarray Probes on PGSC0003DMT400076791

Probe IDChipProbe Sequence
CUST_20247_PI426222305 JHI_St_60k_v1 GCCATTATGCTTGTAGGTACTTACACTTCTGTGTTACAAATTATCAGTCATTTGTAAGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400076791

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400076791 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G15240.1 +1 1e-151 443 236/397 (59%) Transmembrane amino acid transporter family protein | chr5:4947762-4950211 FORWARD LENGTH=423

Transcript Sequence (1505 bp)

>PGSC0003DMT400076791 1505 pgsc_dm_v3.4
GTACACGTAATTTAAGACGCATTGTCATATCTTATCACATAAAGAGTCAATTCTGGTTGT
TTTTCACCCACAAGAAGTGTGCTAACTCTCCACTACTTCTTCTTCTTCTATTTGATTTGA
TTTTAGAACAAACATAGGAAGAAGAGTTAATTAATTATGGAGCCTAAATCAGATGATGGC
TCCTCAAATATAAGAGTGCGTCTACTATACAATGATGGCAGAATTGAAGATAATACTATT
TCAGGACCAACATCTTTTTCAAGAACTTGTTTCAATGGACTCAATGCTTTGTCAGGAGTT
GGCATACTTTCAGTACCTTACGCATTAGCATCAGGAGGATGGTTAAGCTTAATATTTCTC
TTCATTATCGCTATATCAACCTATTACACTTCCTTATTAATTCAAAGATGCATGGACATT
GATCCAACCATAAGAAATTACCCTGACATCGGGGAACGCGCCTTTGGAACTATGGGAAGA
ATGCTTGTCTCCACGACGATGAACGTAGAACTTTATATGGTTGTAACAGGTTTCTTGATT
TTAGAAGGAGATAACTTGCAAAACTTATTTGGAGACCACATACAACTTCAAATATTTGGA
CTTGATGGAAAACAATGTTTTGTGATTATTATAAGTCTTATTATTCTGCCTACAGTTTGG
TTGAACAATATGAGCATCCTTTCTTATATATCTGCAACTGGAGTGCTGGCATCTATTGTG
TTACTTGCATCTATTTTATGGGCTGCTTTATTTGATGGCATTGGGTTTCAAACAAGTCAA
ACTCACTTTATTAATTGGAAAGGGATGCCAACTGCTATTAGCCTCTATGCCTTCTGTTAT
TGTGCTCATCCAGTTTTCCCAACCTTATATACTTCCATGATAAATCCAAAAAAGTTCTCA
AAGGTGATGTTTGTTTGCTTTCTACTTTGCACCATCAGCTATGCATCAATGGCTATTGTT
GGATATCTCATGTTTGGTCCAAGTGTACTTTCCCAAATAACCTTAAACCTCCCCACCAAT
AAAATCAGCTCAAAAGTTGCAATTTACACCACACTAGTCAATCCAATTGCAAAGTATAGC
TTGATGATAAAACCACTAGAAAATAGTATTGAAAATCAACTTCCAATTCATTACAAAGCA
AGGGTATGCAGCCTACTTATAAGAACAGCTTTAGTAATTAGTACTGTCATTGTAGCATTA
GCTATCCCCTTTTTTGGATATCTCATGTCACTTGTTGGAGCATTTTTGAGTGTTACAGCT
TCCATAGTACTACCATGTTTGTGCTTCTTGAAGTTCTCTGGGATTTATCAAAGACTAGGA
TTTGAGCAAGTATTTATAGTGGGGATTGTGATAATGGGCATAGCCATTATGCTTGTAGGT
ACTTACACTTCTGTGTTACAAATTATCAGTCATTTGTAAGTGAAATATTTCACATACTTA
CTTTTCTCATGGATTTGATTTTTATATAGATGTCCTAATAACTACTCTCTTCCTTTTAAT
TTGTG