Microarray Probes on PGSC0003DMT400076379

Probe IDChipProbe Sequence
CUST_15980_PI426222305 JHI_St_60k_v1 CGGTTGTTGTTGGATTATAATGGGTATGTTGTTTGTTGAGCATACTGACTTTGTAATAGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400076379

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400076379 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G28260.1 +1 3e-76 267 211/666 (32%) Telomerase activating protein Est1 | chr1:9875776-9878782 REVERSE LENGTH=880

Transcript Sequence (2412 bp)

>PGSC0003DMT400076379 2412 pgsc_dm_v3.4
GTTTTAAATGATGTCAATCATTAGTGTTAGAAACTCTTAAGACTTCAGCTGTTTCTTTAA
TGCAGCTTGGAAGACTTTCAATCTACTGTTGCATCTACTGTGCGACAATTGGAAGGCCTG
GTGGTAATGGATGATGATGAATTAAAGGCTTCTCTCGAGTCTTACCAGTTAATGGATCCA
TTGAGAAGAGGCCCTTATCGTGCTCTTCAACTTGTCTCTGTTTTCATCTTTATCTTCCAT
AGCCTGACTGAGAGTGGGGATGGCTTGGATCCAAAGAAAGATAACAAGCAGCAATCTGCA
TTGACAGAGCTGGCAGTAGCTGCTACTTTTATTTGTGCTGGTCGCCTCGTTGAGAAAGCT
GCAACAAGAAATAGCACACAAACTTGCCCCCTTTTACCCACCGTTTGTGTGTTTGTAGAG
TGGTTAGTTAACATACTTGATAGAGCAGAAGCACACGCAAGAGATGAAAAGGTCCAGAGT
GCTATATCTTACTTTTTTGGTGCTTTAGCTGATCTTCTGAACCGGCTTGATCCTTGTGAG
AATGAACTTGCTCTAGAAAGTACTGCTCTTTGGGAAGACCATGAACTGAAGGGGTTTCAT
CCCATGGCCCATGCTCACAAGTCTTTGGACTTCACGAGCCATTTGGAATGCATTGATAAT
TTCAGTAGTAAGAGTGTGTGTCGTTCACAGCGTATCTTTCGTGCAGCATCTAAACTGGCT
CACAGATCCAGTCACTCAAGAAAATGGATCTCTTATGATAAAACAGACAAAAGATTCCAC
ATCATGGACTCAGAATTAGCAGATAGGGGAAAGCCAGGAGTAGCTGAATCTGTTTCGACT
CTTCCGCTAAAAGAGACCTATCAAAATAATTGTGGAATGGCAATGGAAAACGGAGAGAGT
CAAGATCATCCTTGTCTCAGCAGCCAATCCGTTACCACAGATGAGGAAGAAGTCATTCTT
TTCAAGCCCATCACTAGACATAACTCAGAACCAATATATACATCAGGCACTTCATGTGAT
CAATTCTCCATCAATGTTATCAATGGAACTGCGGCTTCTGATGAATCCTTGCGCCGTGCC
ACATCGTTGATTTCTGAGCAAAGCAATCCACAGAATGATATTTTCAGTTTCCGTCCAGAA
AGTACAAACTTGAGGTACAACAAGCCGCTCAAGCAATCTGCAGCTTTCCCTGCTGGACCT
CCATCTCTGAATGCTTGGGTCCTTGAGAAGGAAAGTCCAAGAAATGAGAAGGGACTAAGG
GAATTAAATAGGCAGCAGTTAAGCCCAATTGATGAACTAGCTTCTGAATCTTTATCTGGT
CTCTCCTTGAATGAAACTAGAGATCACAACGTTCGTTCCATGCCAGTTTCTGCAGCTATT
CATGATACTCCTCCTCCGTATGTCACTCCAGTCCCCTCAGCTCCACTGTTACCGGAAGAT
GCATCTTGGTTTAAGGGAAACTCATCAGTTTTCCCTAACAAGAGTGCATTTGGGACCAAG
GAAGGGGACGGTATTCTTGGTGCATCACCAGTGGGGGGATACTCAAGTCCATCTACAGTT
CGTGGACCACTTGATTTTGTTGCAGGTGCTCCACGCTTTGTTGAGGGGTACCCACCATTA
CTTGGAATGAGTTCATCTGAATGGCTGTATCACTACAGAAATAGTCAAAACTTCGAGCGA
GTCAGCAATCTGGTATGGCCTGTTCACTCAAACGCACCAGCAACCTATGGAAACCTGAAC
GCGACCAATCTTACCAGGTTTGATGTCTTAGATCAATGGGGAAATCACTTGGCTTCTAGT
CCCATGGTGTACTTGGAGAGCCCGCAGTTGCATCCAAGTCCTCCTCTTGCCTATGGTGCA
GAAGAACAAATAATCGATAAACATTTTCTTGGTTACCAAAGAGCATCCCCGTATGTATGT
GGCACTGGAATGGACTTTAGACAGGAGCAGCCAACACTTCTTAACTATCTCAAAGAGAGA
GAACGGCAAATACCACCAGAGTCTCAATATAAAGGTCCTAATTTTATGGGAAACTAAGCT
CTATGAATACTCATTATCTATCAGGCATTTTTCCACCTGCATTGCCTTAATTCTCAACGT
ATAAATACATGAATTGCGGCATCACAAACTTTCTAAGTGTGAAATGTGTACCAATTTAGA
TGGATGAAATATAGAAATGTATGCATTTAATTGGTTGTGAACTGAGAAAGTGTTATCTAG
AATCTTTAACTTGTAGAATTGTTGAAGATGAATGCACTTTTCTCATTTTGTAAAGTTGTT
TTGTTTTTTAAAAGTCATCTGCAGTGAATGTTTATAGCAAAGAATTGTAGAACATGAGCA
TATAGACGGTTGTTGTTGGATTATAATGGGTATGTTGTTTGTTGAGCATACTGACTTTGT
AATAGAAAATTT