Microarray Probes on PGSC0003DMT400075890

Probe IDChipProbe Sequence
CUST_29452_PI426222305 JHI_St_60k_v1 AGCTAATAGAGCAATGCGGATGGGAATGTTATCGGACAGGTACGCTAGCTTAGCATCATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400075890

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400075890 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G66140.1 +1 5e-25 98 68/170 (40%) zinc finger protein 4 | chr1:24620063-24620845 REVERSE LENGTH=260

Transcript Sequence (432 bp)

>PGSC0003DMT400075890 432 pgsc_dm_v3.4
ATGAAGCCTTCCAATTTCAACCTTGAATCAGAAGACGAGTCCAAGGTCAGCAACTGCCAA
GTGGGTTCAAACATATCCGTCCAAGAAATTCGCCCTGGTCCTTCCCTTAATCTTCAGCAG
GAATCAGTTCCTATTACTCTTGACTTGACTCTTGGCTTCAACAGCAGTGACTCCGAGTTG
AAAACCAATGGAGAGGCGAGTGATGAAGTAGTACCCCATCCTCCAACGGCAGCACTATCC
CGAGTTTTCTCGTGCAATTTCTGCAGACGCATGTTTTACAGCTCCCAGGCGTTGGGCAGA
CATCAGAACGCACATAAGAGGGAGAGGACTTTAGCTAATAGAGCAATGCGGATGGGAATG
TTATCGGACAGGTACGCTAGCTTAGCATCATTGCCCCTTCACGGGGCTGCATTTCGATCT
CTTGGCGTTTAA