Microarray Probes on PGSC0003DMT400075870

Probe IDChipProbe Sequence
CUST_29477_PI426222305 JHI_St_60k_v1 ATTCCGGAAATATTATCATGTAAAATTCTGCTATCACACTTTGGGAGGACTTCAAGATCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400075870

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400075870 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G01910.1 +1 0.0 680 383/622 (62%) Microtubule associated protein (MAP65/ASE1) family protein | chr2:417191-420182 FORWARD LENGTH=608

Transcript Sequence (2105 bp)

>PGSC0003DMT400075870 2105 pgsc_dm_v3.4
GGAAGGAATAGTAGTAGTTAGTTTTTGCTGTTTCTCATGTATGTGAGAGACTGCAATTTT
GGTCCCTGATTTATGTAATATGTATTGACTCTGGTTGGTGGTGATGTCCAGCAAATATGG
ACTGACATTGGAGAGAGTGAAGTTGATAAAGACCGTATGCTGTTGGAGCTGGAAAGAGAG
TGTATGGAAGTTTATCGAAGAAAAGTTGAAGAAGCCGCCAATGCAAAATCGCGTCTTCAT
CAGTCTGTTGCAGCTAAAGAAGCTGAGCTTGCAACCTTAATGGCTGCTCTTGGTGAACAC
AACGTTAATTCACCGATACAGTCAGAGAAAATGTCAGCTTCATTGAAGGAGCAGCTTGGG
TTAATCATGCCTCTTGTTGATGATTTAAAAGCAAAGAAAGATGAGAGAGTTAAGCAGTTC
GCAGATATAAAGACGCAAATTGAGAAAATAACTAGCGAGATTTCAGGGTCTTGTAATATT
GTCAACTCTTTTAGTACCTTAAACTTGGAAGAACATGACTTGTCGACAAGAAAGCTCTCT
GAATGCCAATCCCATCTACGTGCTCTTCAAAAGGAGAAGTCTGTGCGTGTCCAAAGAGTT
CTGGACAGTGTGAATGAGGTTCACACATTGTGCGGTGTACTTGGGCTGGATTTTGGTGAA
ACTGTTAGCAATGTGCATCCAAGCTTGCACGAGACAAGCATGGGACAGTACACAAACATC
AGTGACAGCACATTGGAAGGTCTAGACCAGGCTATCCTTAAACTGAAAACAGAAAGAAAA
GTTCGATATCAGAAGCTAAAGGACGTGGCGGGATCTCTGTTTGAGCTTTGGAAGTTGATG
GATACAACGAGAGAAGAACGGCGTAAGTTATCAAGGATCATTTCCTTTCTTGACATTTCT
GAATCAAAGGTTGTGGAACCAGGTGCACTTACGTTGGAGGTTATTCAACAGGTATCAGCA
GAAGTTGGGAGGCTTACCAAATTGAAAGCAAGCAGAATGAAAGAGTTGGTGATGAAAAGG
AGGGCAGAACTGGAGGATTTGTGCTGTAAAACCCATATACAACCTGATTCAAGTACTGCT
GCTGATAAATCCAGTGCAATGATCGACTCTGGTAAGATGTCTGACTTGGATTCATTAAGT
ACTTTGTTCATCTGAACTTCAATGCAGGGAAATGAGCTCAATCTCCATTTAGGTCTTGTG
GACCCTTGTGAACTCCTGGCAAATATTGAAGCACAAATAAACAAAGTAAAGGATGAAGCT
TTAAGCCGAAAAGAAATTATGGATAAGATAGAGCGGTGGCTTTCATCATGTGATGAGGAA
AACTGGCTTGAAGATTATAACCTGGATCATACACGTTACAGTGGTGGAAGAGGTGCTCAT
ATAAATTTAAAGCGAGCAGAACGAGCAAGAATTACAGTGACTAAGATTCCAGGTATTCTA
CTCTAGCTTATTCGGTGGTGTCATTTAAGCTTGTATCATTGACACAAAGTGAATCCATGG
CTTTTATGCTCAGGTATGGTTGACAGTTTGATTAGCCGGACTCTAGCTTGGGAAAATGAG
AATCAGAAGTTGTTTCTGTATGATGGGGTGAGATTGGTGTCAATATTGGAGGATTACAAA
GTGAGTCGACATCAGAAAGAAGAGGATAAGAAACGTGCCCGGGATCAGAAGAAACTCCAA
GATATGCTTCTGGCAGAGAAGGAATCTATATATGGTTCTAGACCTAGTCCCAGAAGAAGC
AACAGCTTTAGGAAGACGAATGGATTCCATACAAATGGAAATGGGTCAGTCACTCCCTCA
CCACGCCGAAACTCAGTTGGTTGTGCAACTCCAGAGCTTCAAACACCCCGTTCTTACTCT
GGGCGGCAGAATACCTATTTCAAGGAAATGAGAAGGCTTTCTACTGTCCCTCTCAACTTT
GTGGCTATGGCAAAGGAAGATACCATGTCATTTTCTTCGATTGGCGGTTCTGAGCCCGAA
TCTCCACCTCAAGGCTGAATTCACAGTCGGTAAGCTTGTCCCATTTTTTTGCTGCATTTC
TTTTAATTCCGGAAATATTATCATGTAAAATTCTGCTATCACACTTTGGGAGGACTTCAA
GATCA