Microarray Probes on PGSC0003DMT400075050

Probe IDChipProbe Sequence
CUST_49067_PI426222305 JHI_St_60k_v1 CTTATTGTTTTCGTCTGTGGTGTTGAATGTTTATACCCGTCGAAAATTCTTGTTTATGAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400075050

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400075050 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G21220.1 +3 1e-41 139 72/101 (71%) SAUR-like auxin-responsive protein family | chr2:9089380-9089694 FORWARD LENGTH=104

Transcript Sequence (626 bp)

>PGSC0003DMT400075050 626 pgsc_dm_v3.4
GTTACCACCCACACAAAACATCCATAGCCCACATGCCTTTGTTCTTCCAATAAATACACC
TCTATCTTTCTAATTCTTTGCCAACACATAAATTAAACTATTCTACTATGGCTCTAAAGA
AAGCAACTCAAACAGCAACTCTTAAACAAATCTTGAAAAAATGTTCTAGCTTTGGAAAAA
ATGAAAATGGGCTACCAAATGATGTCCCAAAAGGACATTTTGTGGTATATGTGGGAGAAA
ATAGGAGTAGATATATTATTCCAATTTCTTGGTTGACTCATCCTGAATTTCAAAGTTTGC
TTCAAAGGGCTGAAGAAGAGTTTGGATTTAATCATGATTTGGGAATTACTATTCCTTGTC
ATGAACATGATTTCTGCTCTCTTATTTCTAACTTTTGATCGATCAGTCGGTGCACTAAAT
ATCTCGCTATGCACGGAATTCAAGAAGGGGAGAGGAGATCTAGCAAATCAAAGTGGATTT
GCTAAAAAAAATAAAATAATTGTGAATACTAGAAATTTTGTATATTGGTTTTCATGCACT
CTTATTGTTTTCGTCTGTGGTGTTGAATGTTTATACCCGTCGAAAATTCTTGTTTATGAG
AATCAATTAAATTCCAAAAATATTTC