Microarray Probes on PGSC0003DMT400074985

Probe IDChipProbe Sequence
CUST_9997_PI426222305 JHI_St_60k_v1 TGCTTTCCTTCAAGGATCATTGCAGGAAGAAGTCTATATGAATTTGATGTGAGGTCAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400074985

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400074985 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G60580.2 +2 9e-153 463 247/449 (55%) RING/U-box superfamily protein | chr5:24354298-24356706 FORWARD LENGTH=494

Transcript Sequence (2776 bp)

>PGSC0003DMT400074985 2776 pgsc_dm_v3.4
TTTCTTTCTTTCTTTCTTTCTTTTTGCTTTAGAAATATTTATTATATACAAGTACCATCT
TGTTGTTCATATAAACAGTAGTGTTTTTCAGTTCTCAGGGGAAAAATACACACACCAGAA
CTGGGTCTTTTTTCATCTTCACATGATGAGGTGTGAACAGAAGGATAAATCAATGGCTGA
GGTGTATGATGAATATGTTAGAAGTAATGTTTGTGAAAGAGTTGCTATTCAAATCCCTCA
GGGTAAAAGTTCCTCAGGGATTACTGAAGAAAGTGAACATGCTAAGCAATGGAAGAGACC
AAATCTATTTGTGGAGATACCTTCCAAATCATCGGATGCCTCTAATCAAGAGTCTGTGCA
AGTTAAAATGCTTTCAGCACCCACGCCTACACCAAAAAGGGTGAATTTCCTTTTGACACC
TAGTCCTTCTAATTCGAGAGCAAACGCTTTTCCTAGTCCGTCATCATGCAGAGGCAAATC
ATCCATCAAGAGTCTTTTGCCAAGACTAAGCTTCAAATTGCGTAATATGAATTCAGATAC
AGAAAAGGCAACCTTACCAGATTCAGATACTTCGGCCATGGTGCCGCAAGAGAAGGTGTC
CATACCAAGGTCATGGTCATTCACTAAATTATTTACACCACGTGTGAAAAGGACGTCATC
GTTACCCGTTACACCAATTGATCATTCAAATCCAGAGTCTGCTAGTGGAAGTATCAGCAG
AGCTATGACATTTGGTCCAAAAGAAACACAACTGCGCATTTCTCGATCACTTTCTCTACC
GGTCATTAACAAAGATCGACGCACTAGGAGAGTTGAATCTTTCTTTCGAGTCATTCCTTC
AACCCCTCAGGGGAAGGATGGGGATTCCACAGTTCCAGCTACACCTCCAGCTAAAGTATC
TGAAGATGAAGAGCCAAATGGTGAAGATATACCTGAAGAGGAAGCTGTTTGTCGAATTTG
TCTGGTTGAATTATGTGAAGGTGGGGAGACACTCAAGATGGAATGCAGCTGCAAAGGTGA
ACTTGCTTTGGCTCACCAAGAATGTGCTTTCAAATGGTTCAGTGTAAAAGGTAACAGAAC
ATGTGACGTGTGCAAGCAAGAAGTTCGAAACCTGCCTGTCACACTTCGTCGCCTCCAAAG
TGCGAATGTGGGATCCAATAGTTTCCAGCACTTGGAAATAAACGGATACAGGGTATCACA
GGAACTACCAATTCTTGTCATTGTCAGCATGCTTGCCTACTTTTGCTTTCTTGAGCAGCT
TCTGGTCGGATCAATGGGTACAGGTGCAATAGCAATATCAGTTCCCTTTTCTTGTGTACT
AGGTTTGCTTTCGTCTTTGGCGTCATCAACCATGGTGAAGAGAAGGTTTGTTTGGGTTTA
TGCGTCGATTCAGTTCATCCTCGTGGTATTCTTTGCTCATATGTTCTACTCCTTGGTTCA
TGTACAAGCTGTTCTTTCAATTCTTCTATCAACATTTGCTGGCTTGGGGGTCGCAATGTG
TGGATGTTCCATACTTATCGAGTTCTTTAGATGGAAAAGGCGGAGACAAGCCGTGTTAGA
TCAACAACAGCAGAATTCCCAGCTGAATCAAACAGAAATATCGTCCCACATAAGTACTCG
TCAAGATTATCAATCGGATTTAGAAAATCCAGGGACAGTTAGTGGGAGCTAGGTAGTCAA
TAAAGCTATAGCAGCTTATAAGGCATTAAAAAAACACAGTTGTTGTGGGGAAATGGAATG
GCTTGTTGTATATATCTCGACGTTACTCACCCTCCACCGGGAAGTAGAAAAGTTCATTGT
ACTGTGAAAGCGTGGAAAGAAAGATACCGACACTTGACTATCATCCCTGTTTCAAAAGTT
GTTTGGCACTGCTCTTAATAGAACCAAACTACGTATCTTTGGATGTCTTTGATCATTTCC
TTGGTTGCGACCTTATGCAAATCATAATCTTGAGTCTCACTCTAAGACATGCATCTCCAT
TGGTTACTCCTCAAATCAAAGCGCCTATAAATTTTATTAACCTATGTTGAAAAAGATCTT
TTTCTCTCATCATGTTCAATTTGTGGAGTCTACATTTCCATGATCCTCGCATCCGTTGAC
ATCTTCCTTTGCCCATGTTTCATGGAATGTTGCATCAAATTATGCCACTCATTTCACACT
ACAAGGTCCCTCACCTGCAAGAAGGCCTTCACATTCACCCGTACCTTCACCTTCTTCAAA
TGTGGACACTGTCATTTCTTCTCCTCCGCGTAGAGAGTCTCCCCAAGGAAGTTCAGATCC
TTTACTGTCTTCTCCACCATGTCAAACATTTTTTCATATACAAAAAGGTCCTACGCATAA
CCATCCTATGACCACACTGTCTCAAAACAAATTTACAAGCCTAAACAAGCATTCACCGCA
ACAAAACATCCCATTAATTCATCAATTGAGCCATCATGTGTTACACAAGCTATTAAAGAT
CCTGAATGCAGAGCAACAATGTCAGAAGAATTTAATGCTCTTGTTAGAAATGGTACATAG
GAACTTGTCCCTTTTCAACTCAATTTAATGTCATTGGTTGTAAGTGGATTTTCAGGGTAG
TTAAAGACTTTCATCAAAGATTCAGGCTTGACTATCATAATAGATTTAGTCATGTTATTA
AAACAGCTACCATTAGAGTAGTTGGAAGTATTGCTTTGCAGCTTGGGTGGAAGATTAGGC
AACTTGATGTCAATAATGCTTTCCTTCAAGGATCATTGCAGGAAGAAGTCTATATGAATT
TGATGTGAGGTCAAAA