Microarray Probes on PGSC0003DMT400074839

Probe IDChipProbe Sequence
CUST_25029_PI426222305 JHI_St_60k_v1 TGAAGCTTGTTACACCCTTGGCATGATTCGATTCTACTGTTTGCAAAATCGAGGAAGCGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400074839

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400074839 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G67340.1 +1 5e-167 483 237/337 (70%) HCP-like superfamily protein with MYND-type zinc finger | chr1:25230323-25231622 FORWARD LENGTH=379

Transcript Sequence (1660 bp)

>PGSC0003DMT400074839 1660 pgsc_dm_v3.4
GTTTGTTTGTTTGTTTTACTTTACCCTTCTTTCTTTACTCTGTCTATCTTTGTTTGTGTG
TATAAAGGAATGAGAACAAGGAGAGGGTTTTGTTATCCAAATCCAAAAGTAAACATGTGT
ATAGAAAACAAAATTGTTAAGAGGAAAAGAAATGATTTTTCTGGCATCGGAGACCGTCGG
AAAAGATCTAAACTTTCGCCGGAGATTACTGGTCATCATCCTGATCTTTTTGATTCTTTG
CCTGATGATCTCGTTGTTTCTATTCTCTGCAAACTCACTTCTTCTGCTGCATCGCCGGCT
GATTTCGTTAACGTTTTGATTACATGCAAAAGACTAAATGGGTTAGGTCATCATTCGCTT
GTATTATCAAAAGCTTCTCAGAAAATGTTAACCGTGAAAGCACAAAACTGGTCGGAATCT
GCTCAACGCTTTCTCAAACAATGCGCCGACGCCGGAAATGTTGAAGCTTGTTACACCCTT
GGCATGATTCGATTCTACTGTTTGCAAAATCGAGGAAGCGGCGCGTCCTTGATGGCGAAG
GCGGCGATTAGCTCTCACGCGCCGTCGCTCTACTCTCTCGCCGTTATCCAGTTCAACGGC
AGCGGTGGTTCGAAGAACGACAAGGACCTCCGCGCCGGAGTTGCTCTGTGTGCACGCGCC
GCCTTCTTAGGCCACATCGATGCTTTGAGAGAGCTTGGTCACTGTCTTCAAGATGGGTAC
GGCGTGAAGCAAAACATAGCGGAAGGTCGGCGATTCCTCGTCCAAGCCAACGCGCGTGAG
CTTGCTGCCGTTTTATCGATGACGCCTTCAGCTCTGACCGCCGGCGGGTGGCTGACGTGG
AACCCGCTGCCTCATCACCGGCACGGAGCAGGTAGCGGGTGCCCGTTACTGAGTGATTTC
GGCTGTAATGTTCCTGCCCCGGAAGCCCACCCGGCTAATCAGTTTTTAACTGAATGGTTT
TTGAATTCTTCGAAAGGCGGAGTCCCGGGTTCCGGGCTCCGGCTTTGTTCACATGCGGGT
TGTGGAAGACCCGAAAGTAGGAGGCATGAATTCCGTCGATGCTCCGTTTGTGGTACAGTT
AACTATTGCTCACGCGCTTGCCAGGCGCTTGATTGGAAGATGCGTCATAAAGCAGAGTGT
ACACTGGTAGAGAGATGGATTGACGAAGACGGAGAAAATGACGGTAACGGTAACGGTGAC
GGCGAAATGGGTGAGGAGGATCAGAATATGGTGGAAAGTTAAACGGCGAGAGTAACAGTG
TGCTTGACTGTGAAGGTGACGGTAACGGCACGTGAGTCTCAAAAATTCACTGGCAGGTAA
AAAAAAAAAAGGAAGAAGGGCCAAGTTAGTGGCCGTTTTTGGGAATATAATTATGGTCTT
TATTTTTGTATAGAACAAGTAAAAAAAAAATTGGGATTGTATGAAGAGGAAAAAGGAGAA
AAGCAAATTATTCTGAAGTCTTTTTTTTGTTTTATTAATATTTTTTAAATAGGAGTATTA
ATTTAGAGTATGGTTGGAAAAAAAAATAGAAAATGAATGGGGAATATGATGATGGGTTCT
CTTTATGCTTGCCTCCCGACCAAATGATATCTCTATTCCTCATTCAACTTCTCTTTAAAT
TTACATGAAATGTGGGCCTATACATTTTACAGCTATTCAT