Microarray Probes on PGSC0003DMT400074600

Probe IDChipProbe Sequence
CUST_28467_PI426222305 JHI_St_60k_v1 TTCCTTTGATTGTTGATTTGCAGGTGATGAATAGTTTCGTTCATTCCTTACCTATGTTGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400074600

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400074600 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G17230.3 +1 2e-68 219 110/146 (75%) PHYTOENE SYNTHASE | chr5:5659839-5662087 REVERSE LENGTH=437

Transcript Sequence (681 bp)

>PGSC0003DMT400074600 681 pgsc_dm_v3.4
ATGGCGCCTCTACCGGGGATGTGGTGCAGGAGAATTGATGAGCTTGTTGATGGCCCTAAT
GCGCCACACATAACTCCAGAAGCTTTAGATAGGTGTGAGGCAAGTCTGGAAGATATTTTT
AATGGGCGGCTATTTGATTTGCTTGATGCAGCCTTATCCGATACTGTTTCTAGATTTCAT
GTTGATAAGCCATTCAGAGATATGGTTGAAGGAATGCATATGGACTTGTGGAAATTCTTA
TACAACAACTTCGATGAGCTATATCTCTATTGTTACTATGTCGCTAGTACAGTAGGATTG
ATGAGTGTTCCAGATATGGGCATTGCACCTGAATCAAAGGCAACGACAGAGAGTGTATAT
AATGCAGCTTTGGCTGTAGGGATCACAATTCAACTAACCAATATACTCAGAGATGTAGGA
GAAGACCGAAATGGAAAGATTCATGTTCCTTTGATTGTTGATTTGCAGGTGATGAATAGT
TTCGTTCATTCCTTACCTATGTTGCTTCGACCCTTCAAAAATGTCGTCAGGTTCAGTGCA
ATAACTTGCTCTTATGAAACTTATAAAGCTGAATTGTTGGGCCCGTGCGCAGCACGGGCA
ATGAATCATCTAGTACCTCAAGATGAATTAGCACAGGCACGGCTCTCCGATGAAGACATT
TTTCGCTGGAAGAGTGACTGA