Microarray Probes on PGSC0003DMT400074570

Probe IDChipProbe Sequence
CUST_36455_PI426222305 JHI_St_60k_v1 ACTGTCGAGAAGAGCCCTTGTGTATTTATTGTAACTGGGATGTTTAATTAGTGTTTTTCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400074570

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400074570 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G19875.1 +3 8e-16 72 49/87 (56%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to oxidative stress; LOCATED IN: endomembrane system; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G31940.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:6718412-6718783 FORWARD LENGTH=123

Transcript Sequence (755 bp)

>PGSC0003DMT400074570 755 pgsc_dm_v3.4
GGAAAAAAGACAACACCACATGAGATTTAGACCTTTATAAAAGCCATAGTAAGCCTACTC
CAAAACCAAACAAGTCTCATTCTGAAGAAAATCAAACTCTTCTTTCCACACTTTGAAGCA
AATTAAAGTTCCAAAAAATGGGAGATAATTACTCATCATCACATCCACCTTCAATACATT
TATGTTTCTTCTTTCTTGTTCTCTTCATGTTTGTAAGTGTTACATGGTACATCAACTATG
AGTCTATCTTTGAAGGCATTATGGATCAATTCAAGTTTCTTCTCATGTTGTCTCCATTAA
TACTACTATTAATTGTTCACTTACTTTCCAACTTTGAAAAATCTCTCATCTTCAATATTC
CTTTGCCTGAACAAGACTCATTTCATAGAGCTGGTGCTACTCCTTGGGGAGTTGGATTTC
TCCTTGTGCTTCTACTCTTCATGATTTCTTATCACTCTGATCTTCGCGAACGATGGTTTC
CTCTTCTAAGTTGAAGAAGAGTATGTTATGAACGGTTACATGTAATTATCTTTTAGTTTG
AGTAACGAAGACTTAAAAAGAGTTTTTGAGTACTGTCGAGAAGAGCCCTTGTGTATTTAT
TGTAACTGGGATGTTTAATTAGTGTTTTTCTTGTTATCTTTTCAATTAGTTTCTTCAATA
TTGGAAAGTTTGTTTTGTTTTTCATGTTGTGGTTATTTCTTAATAATTGTAGGGTTATGA
ATGTGTAAATAATCGTCATTTCTGGTTATTTATTG