Microarray Probes on PGSC0003DMT400074549

Probe IDChipProbe Sequence
CUST_36393_PI426222305 JHI_St_60k_v1 TGTTACACTTGCTTTAACACTCCCCTCTGTTTGTAAAGCCCCTGCTAACATCTCTGAATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400074549

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400074549 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G44300.1 +2 1e-51 171 76/111 (68%) Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein | chr2:18307468-18308286 REVERSE LENGTH=204

Transcript Sequence (838 bp)

>PGSC0003DMT400074549 838 pgsc_dm_v3.4
GGAACCTATTATTTAAGAGCCAAAGGAATGTTCATCTTTTTTCCACTTATCACAAAAACT
ACTAAAAAGGCAAAAACAGAGTTCAAGACACCTCAGTTCCCTCTATAAACATTTCAATAT
GGTTTCTTGCACCATGAAATATCAGTTGAGATTGGTGTTGTTCTTCATATTATGTGTATT
TGGAAATTCAGATACAGAAAAGGACAAAGAAGAGTGTACACAATCATTGATTGGTTTAGC
AACATGTTTGCCTTATGTTGGAGGTAATGCACCAGCTCCTACACCAGATTGCTGTACTGG
ATTGAAACAAGTGTTGAAAGCCAGCAAGAAGTGTCTTTGTTTGTTAATTAAGGATAGAAA
TGATCCTGATTTGGGACTTCAACTCAATGTTACACTTGCTTTAACACTCCCCTCTGTTTG
TAAAGCCCCTGCTAACATCTCTGAATGCCCTGCACTTCTCCACTTGCCTGCAAATTCACC
AGAGGCTCAAGTATTCTATCAAATTGCTAATAATTCAAGCAGCATTGCTGGCAGTCCATC
TGCACATAGCCCCATTCCTTCTGTTGGATCTAGTCCCACAGGTGCCCCTGCTGGTGCTCC
TAAATCTGCTGGTTGTCATATTGGAAAGAGATGGTTTGGATTAGAAGCAATTGTTGGTGT
AGTCCTTCTTTGGTCTTTAACTTCAAATTTCTTCATATGATGAGTCTAATAACCTTATTT
GTATCATAATAATTAAATCTATCATTTTGTTAAATGGATGATCCTTGTATTCTTGTGTGT
CCTTCTAATTTGATATTTATTCACTAATATTTTCTCAGAGTGATACATTGAGGGCAAC