Microarray Probes on PGSC0003DMT400073660

Probe IDChipProbe Sequence
CUST_40762_PI426222305 JHI_St_60k_v1 TTCTTTACTATTGACATCCAACCCTGCCATTCAGTAATCTCTCTGATGTTCTGGTGGAGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400073660

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400073660 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G05290.1 +3 1e-142 418 233/302 (77%) peroxisomal adenine nucleotide carrier 1 | chr3:1506129-1507614 REVERSE LENGTH=322

Transcript Sequence (1610 bp)

>PGSC0003DMT400073660 1610 pgsc_dm_v3.4
GCCGCCTACTTTTTTTTTTTCTCACAGACGTGTTTGTTAAAAGATCAATTATTTTCAAAT
TTGTATAAAGGTAGAGTGTTCAATTTTGATGTGGTAAATACAATTCTTGATTATAATTTG
TATAGTTTTAGAAAGAGAGAGAGGAAATGTCAGCTGATCTGGAATCCATATCAGAAGCGA
CTTCTGGAGCCATTGGAGCTCTAGTTAGCACTACTATCTTGTACCCTCTTGACACCTGCA
AAGCTAAGTACCAAGCAGAGGTTCAAGCTCATGGTCTCCGTAAATACAGTAATCTCTCTG
ATGTTCTGGTGGAGGCAATATCAAAAGGTAAGATACTGTCACTGTACCAAGGTCTGGGAA
CCAAGAACTTGCAATCTTTCATTGCGCAGTTTGTGTATTTCTATGGATATAGCTACTTTA
AGAGACTCTATTTGGAGAAAAGTGGTTCCAAATCCATTGGAACAACAGCCAATTTGCTAA
TTGCAGCTGCAGCTGGCGCTTGTACAGCCATAACAACTCAGCCACTGGATACTGCTTCCT
CAAGGATGCAGACAAGTGCATTTGGGAAATCAAAAAGCCTTTGGAAAACACTGACAGAAG
GTAGTTGGAGTGAAGCATTTGATGGCCTAGGGATTTCTTTACTATTGACATCCAACCCTG
CCATTCAGTATACAGTTTTTGATCAACTTAAACAACGATTGCTGAAAGATAAAGAGAAGA
CAACAGAGAAAGGCACATCATCGCCTGTTGTACTTTCTGCATTCTCTGCTTTTGTATTAG
GTGCACTGTCAAAGAGCATAGCCACTGTTCTAACCTATCCAGCGATCAGGTGTAAGGTGA
TGATTCAAGCAGCAGACAATGACGAGGATAAGAAGGCTGAACCTAAATCAAGTAAGACAA
TCAGTGGTGTCATATGCTCTATCTGGAAGAAAGAAGGATTCTTGGGTTTCTTCAAGGGAT
TACATGCTCAAATCCTCAAAACAGTGTTAAGCTCTGCATTGCTTCTAATGATCAAGGAAA
AGATCTCTGCCACAACTTGGGTCCTCATACTTTCACTTAGGAGATTTCTGCTGCTCAGGC
AGAGAAAGCTAAAAAGTGCTTAAATTGTGAGCATTTAAAAGTGCTGAGTCTGTGTGAAAA
AAAGGCTTATATGAGAAATCAGAAGAAGAAAGGGAGTTCATTGCAAGGTTGCAGTCTAAG
TAGTTAGTTCCAATTACAGTCTGCAAGGTGCTCTAGCAGAATGATGAATTTAAGAGAACA
ATATGATAGTTTTTGGTCTTCTTAGAAGAGAATAATTTGACAAGATTTTTTTTCTTCTTC
TTTTGATGACGTTAGAATAATGTGGTTAAAGAATCTCTTTTTAGTTACTCTGGAACAAGT
CTTTAGAAGAAATATTGGGGTTTTACTTCTGGCGGCAACATGATTGCACCTACTTTCAAA
GCTCATTGTGATATCTTCTTGACTTTGGATTCTCGTTAGCATTTACTTGTCCAAGTATTG
CGGAACCAGGAGAAAGATACAATTTTATTACTACGTATATTCAAACTATATTATTGGATT
TATTTAAAGTCAGCGCGTCTGGGAGATCTCTATTATTTAATAGTATGTGT